B-ALB-CreERT2 Mice

Basic Information

Strain Name
C57BL/6-Col1a1tm1(ALB-CreERT2)/Bcgen
Stock Number
B-CM-014
Common Name
B-ALB-CreERT2 Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Col1a1 (collagen, type I, alpha 1); Alb (albumin)
Species
C57BL/6
Appearance
Black
Genotypes
Heterozygous

Description

Alb gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
EGE-ZK-014-L-GT-F TACTTCCCTACCCAGCACCCTCAAA 62 2528
EGE-ZK-014-L-GT-R AGCAAGCAATACCATGACAAAAGTGT 59
EGE-ZK-014-R-GT-F GGCTCTACTTCATCGCATTCCTTGC 61 2583
EGE-ZK-014-R-GT-R GACAGTGAGGGTCTTGGAAACAGGG 62
EGE-ZK-014-GT (in)-F GGTGTTAAGTACGCTGGAGCTGTCA 61 3708
WPRE-120R ACGGGAAGCAATAGCATGATAC 56

Enzyme: KOD-plus

 

References

1. Hochedlinger, K., Y. Yamada, et al. (2005). "Ectopic expression of Oct-4 blocks progenitor- cell differentiation and causes dysplasia in epithelial tissues." Cell 121(3): 465-477.
2. Beard, C., K. Hochedlinger, et al. (2006). "Efficient method to generate single-copy
transgenic mice by site-specific integration in embryonic stem cells." Genesis 44(1): 23-28.

Back to top