B-ALB-CreERT2 Rats

Basic Information

Strain Name
SD-Alb tm1(CreERT2)/Bcgen
Stock Number
B-CR-019
Common Name
B-ALB-CreERT2 rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Alb (albumin)
Species
Sprague Dawley
Appearance
White
Genotypes
Hemizygote

Description

Alb (albumin) gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs. In this strain, Cre recombinase expression is under the control of Alb promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Alb expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size
(bp)
B-CR-019- Primer1 TGCCGTGGTTAGAGTCCTTCAAGAG 61 2958
B-CR-019-Primer2 GGCAGAACAGGTAGTTGTTGGGGTC 62
B-CR-019-Primer3 AGGAAATGGTTCCCTGCTGAACCTG 62 3436
B-CR-019-Primer4 CTTCAGTACCCCTCCAGATCACCCAG 62

Polymerase: KOD-plus

 

 

 

 

References

1. Krupczak-Hollis, K., Wang,X, et al. (2004). "The mouse Forkhead Box m1 transcription factor is essential for hepatoblast mitosis and development of intrahepatic bile ducts and vessels during liver morphogenesis." Dev Biol 276(1): 74-88.
2. Cohen, P., Zhao, C, et al. (2001). "Selective deletion of leptin receptor in neurons leads to obesity." J Clin Invest 108(8): 1113-21.
3. Kellendonk, C., Opherk, C, et al. (2000). "Hepatocyte-specific expression of Cre
recombinase." Genesis 26(2): 151-3.
4. Postic, C. Shiota, M, et al. (1999). "Dual roles for glucokinase in glucose homeostasis as determined by liver and pancreatic beta cell-specific gene knock-outs using Cre recombinase." J Biol Chem 274(1): 305-15.

Back to top