Basic Information

Strain Name
C57BL/6-Apoetm1/Bcgen
Stock Number
B-EM-021
Common Name
B-Apoe-KO mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Apoe (apolipoprotein E); Apo-E; AI255918
Species
C57BL/6
Appearance
Black
Genotypes
ApoeKO (mut/mut);
Development
The ApoeKO mice were developed by Beijing Biocytogen Co., Ltd., the targeted mouse Apoe exons 3 was replaced with pGK-Neo cassette resulting in inactivation of Apoe protein. This strain was on a C57BL/6 genetic background.

Description

Apolipoprotein E (ApoE) is primarily produced by the liver and macrophages in the peripheral tissues, or by astrocytes and microglia in the central nervous system. ApoE transports lipoproteins, fat-soluble vitamins and cholesterol into the lymph systems, and then into the blood, preventing the accumulation of cholesterol-rich particles in the plasma. The function of ApoE protein has been widely studied in cardiovascular disease, lipid metabolism, and Alzheimer’s diseases.

Targeting Strategy

B-Apoe KO Rats-targeting-strategy

Details

Genotyping Information

Primer Sequence Tm

)

Product size (bp)
ApoE-Primer-1 TGAGGCGGTTCTGAGACCTC 59 WT: 194
ApoE-Primer-2 TCAGAGTTCTAGAGGGAATTGGC 57
ApoE-Primer-1 TGAGGCGGTTCTGAGACCTC 59 WT: 826

Mut: 383

ApoE-Primer-3 GTCTCAAGAAGCCAAAAGCCAATC 58

Polymerase: 2XTSINGKE Master Mix(bluc)

 

References

  1. Ishibashi S; Herz J; Maeda N; Goldstein JL; Brown MS. 1994. The two-receptor model of lipoprotein clearance: tests of the hypothesis in knockout mice lacking the low density lipoprotein receptor, apolipoprotein E, or both proteins. Proc Natl Acad Sci U S A 91(10):4431-5. [PubMed: 8183926]
  2. Miura Y; Chiba T; Tomita I; Koizumi H; Miura S; Umegaki K; Hara Y; Ikeda M; Tomita T. 2001. Tea catechins prevent the development of atherosclerosis in apoprotein E-deficient mice. J Nutr 131(1):27-32. [PubMed: 11208934]
  3. Ekuni, D., et al., Occlusal disharmony accelerates the initiation of atherosclerosis in apoE knockout rats. Lipids Health Dis, 2014. 13: p. 144. [PubMed: 25189624]
Back to top