B-CAG-tdTomato cKI Mice

Basic Information

Strain Name
C57BL/6-Gt (ROSA)26or tm5(CAG-LSL-tdTomato) /Bcgen
Stock Number
B-CM-066
Common Name
B-CAG-tdTomato cKI Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
ROSA26 (R26, AV258896, Gtrgeo26, Gtrosa26, Thumpd3as1)
Species
C57BL/6
Appearance
Black
Genotypes
Heterozygous

Description

ROSA26 gene produces a long non-coding RNA (lncRNA) that is under the control of a constitutive promoter. This locus is a widely used site for the integration of transgenes and reporter constructs.

Targeting Strategy

Details

Phenotype

B-CAG-tdTomato-cKI-mice-Details

T cells were isolated from spleen in single positive mice and double-positive mice.The proportion of lymphocyte subpopulation were analyzed by flow cytometry.

Results: tdTomato+ cells were detected in the double-positive mice

Protein expression analysis (peripheral blood )

B-CAG-tdTomato-cKI-mice-Results

T cells were isolated from peripheral blood in the single positive mice and the double- positive mice. The proportion of lymphocyte subpopulation were analyzed by flow cytometry.

Results: tdTomato+ cells were detected in the double-positive mice.

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
ROSA-GT-F AGTCGCTCTGAGTTGTTATCAG 55 WT:469
Mut:6044
ROSA-GT-R TGAGCATGTCTTTAATCTACCTCGATG 57
ROSA-GT-F AGTCGCTCTGAGTTGTTATCAG 55 Mut:268
ROSA-PCR-R AGTCCCTATTGGCGTTACTATGG 57

Enzyme: Taq

 

 

References

1. Srinivas, Shankar, et al. "Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus." BMC developmental biology 1.1 (2001): 4.

Back to top