B-Camk2a-Cre Rats

Basic Information

Strain Name
SD-Camk2a tm1(Cre) /Bcgen
Stock Number
B-CR-001
Common Name
B-Camk2a-Cre Rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Camk2a (calcium/calmodulin-dependent protein kinase II alpha7); PKCCD; PK2CDD
Species
Sprague Dawley
Appearance
White
Genotypes
Camk2a Cre (wt/mut)
Development
A P2A-NLS-Cre sequence cassette was placed between the coding sequence of exon 18 and 3’UTR of the Camk2a gene using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background.

Description

The Camk2a gene encodes alpha subunit of CAMK2A (Calcium/calmodulin-dependent protein kinase II), which is a ubiquitous serine/threonine protein kinase that is abundant in the brain as a major constituent of the postsynaptic density (PSD). In this strain, Cre recombinase expression is under the control of Camk2a promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Camk2a expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Camk2a Cre primer 1 GAAGAAAGACTGGTGTCACGGGGTC 62 Mut: 2675
Camk2a Cre primer 2 AGTCATCCTTAGCGCCGTAAATCAATCG 62
Camk2a Cre primer 3 TGAACGTGCAAAACAGGCTCTAGCG 63 Mut: 2324
Camk2a Cre primer 4 GAGAGGCAGCAACGTAATTCCAAG 62
Camk2a Cre primer 5 CTCCGTCCTGCCCCAGTAAGAACT 63 Mut: 1700
WT: 584
Camk2a Cre primer 6 CCAAAGCTAGGCCAGGCTAACAAGAG 62

Polymerase: Taq

 

References

1. Mayford M; Bach ME; Huang YY; Wang L; Hawkins RD; Kandel ER. 1996. Control of
memory formation through regulated expression of a CaMKII transgene. Science
274(5293):1678-83. [PubMed: 8939850]
2. Santacruz K; Lewis J; Spires T; Paulson J; Kotilinek L; Ingelsson M; Guimaraes A; DeTure M; Ramsden M; McGowan E; Forster C; Yue M; Orne J; Janus C; Mariash A; Kuskowski M; Hyman B; Hutton M; Ashe KH. 2005. Tau suppression in a neurodegenerative mouse model improves memory function. Science 309(5733):476-81. [PubMed: 16020737]
3. Thiagarajan, T. C., Piedras-Renteria, E. S., Tsien, R. W. Alpha- and beta-CaMKII: inverse
regulation by neuronal activity and opposing effects on synaptic strength. Neuron 36: 1103-
1114, 2002. [PubMed: 12495625]
4. Lu, C. S., Hodge, J. J. L., Mehren, J., Sun, X. X., Griffith, L. C. Regulation of the Ca
(2+)/CaM-responsive pool of CaMKII by scaffold-dependent autophosphorylation. Neuron 40: 1185-1197, 2003. [PubMed: 14687552]
5. Karcher, R. L., Roland, J. T., Zappacosta, F., Huddleston, M. J., Annan, R. S., Carr, S. A., Gelfand, V. I. Cell cycle regulation of myosin-V by calcium/calmodulin-dependent protein kinase II. Science 293: 1317-1320, 2001. [PubMed: 11509731]

Back to top