B-CD150-iCreERT2 Mice

Basic Information

Strain Name
C57BL/6-Slamf1 tm1 (iCre/ERT2) /Bcgen
Stock Number
B-CM-175
Common Name
B-CD150-iCreERT2 Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Slamf1 (signaling lymphocytic activation molecule family member 1)
Species
C57BL/6
Appearance
Black
Genotypes
Heterozygous

Description

Slamf1 (signaling lymphocytic activation molecule family member 1), also known as CD150, encodes proteins mainly expressed in thymocytes and hematopoietic stem cells, activated T cells, B cells, and macrophages. Activation of Slamf1 promotes the secretion of IFN-γ of IL-2 and TNF-α, etc.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
B-CM-175-WT-F AGACTGTAAGCCTGATGCTGTGCTG 62 Mut:321
B-CM-175-Mut-R TCCTGACTTCATCAGAGGTGGCATC 61
B-CM-175-Mut-F GGTGCCCCTCTATGACCTGCTGC 65 Mut:331
B-CM-175-WT-R GATCCGTCACCAGGGAACTGATTGG 62
B-CM-175-WT-F AGACTGTAAGCCTGATGCTGTGCTG 62 WT: 323
Mut:2372
B-CM-175-WT-R GATCCGTCACCAGGGAACTGATTGG 62

Enzyme: KOD-FX

 

 

 

 

References

1. Wang N, et al., The Cell Surface Receptor SLAM Controls T Cell and Macrophage
Functions. J Exp Med. 2004 May 3;199(9):1255-64

Back to top