B-Col10a1-iCre Mice

Basic Information

Strain Name
C57BL/6-Col10a1 tm1(iCre) /Bcgen
Stock Number
B-EM-001
Common Name
B-Col10a1-iCre Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Col10a1 (collagen, type X, alpha 1); Col10; Col10a-1
Species
C57BL/6
Appearance
Black
Genotypes
Col10a1 iCre (wt/mut)
Development
A F2A-iCre sequence cassette was placed between the coding sequence of exon 3 and 3’UTR of the Col10a1 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Description

The Col10a1 gene encodes a short-chain minor collagen of cartilage which is a direct transcriptional target of RUNX2 during chondrogenesis. In this strain, Cre recombinase expression is under the control of Col10a1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Col10a1 expressing cells.

Targeting Strategy

B-Col10a1-iCre-mice-Targeting-Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Col10a1-iCre-primer1 TCAGGATTCCTAGTGGCTCC 57 WT: 173
Col10a1-iCre-primer2 AACTTGGTCCCAGAGTGCAC 58
Col10a1-iCre-primer1 TCAGGATTCCTAGTGGCTCC 57 Mut: 143
Col10a1-iCre-primer3 TGGTGCACAGTCAGCAGGTTG 61

Polymerase: Taq

 

 

References

1. Maye P; Fu Y; Butler DL; Chokalingam K; Liu Y; Floret J; Stover ML; Wenstrup R; Jiang X; Gooch C; Rowe D. 2011. Generation and characterization of Col10a1-mcherry reporter mice. Genesis 49(5):410-8. [PubMed: 21328521]
2. Zheng, Q., Zhou, G., Chen, Y., Garcia-Rojas, X., Lee, B. Type X collagen gene regulation
by Runx2 contributes directly to its hypertrophic chondrocyte-specific expression in vivo. J. Cell Biol. 162: 833-842, 2003. [PubMed: 12952936]
3. Wallis, G. A., Rash, B., Sweetman, W. A., Thomas, J. T., Super, M., Evans, G., Grant, M.
E., Boot-Handford, R. P. Amino acid substitutions of conserved residues in the carboxyl- terminal domain of the alpha-I(X) chain of type X collagen occur in two unrelated families with metaphyseal chondrodysplasia type Schmid. Am. J. Hum. Genet. 54: 169-178, 1994. [PubMed: 8304336]
4. Thomas, J. T., Cresswell, C. J., Rash, B., Hoyland, J., Freemont, A. J., Grant, M. E., Boot- Handford, R. P. The human collagen X gene: complete primary sequence and reexpression in osteoarthritis. Biochem. Soc. Trans. 19: 804-808, 1991. [PubMed: 1794562]
5. Warman, M. L., Abbott, M., Apte, S. S., Hefferon, T., McIntosh, I., Cohn, D. H., Hecht, J. T., Olsen, B. R., Francomano, C. A. A type X collagen mutation causes Schmid metaphyseal chondrodysplasia. Nature Genet. 5: 79-82, 1993. [PubMed: 8220429]

Back to top