B-Dmp1-iCre Mice

Basic Information

Strain Name
C57BL/6-Dmp1 tm1(iCre) /Bcgen
Stock Number
B-EM-003
Common Name
B-Dmp1-iCre Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Dmp1 (dentin matrix protein 1); PP; Dmp; AV020965
Species
C57BL/6
Appearance
Black
Genotypes
Dmp1 iCre (wt/mut)
Development
An F2A-iCre sequence cassette was placed between the coding sequence of exon 6 and 3’UTR of the Dmp1 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted within the non-conserved region of intron 5. This strain was maintained on a C57BL/6 genetic background.

Description

The Dmp1 gene encodes the dentin matrix acidic phosphoprotein 1, an extracellular matrix protein and a member of the small integrin-binding ligand N-linked glycoprotein family. This protein is critical for proper mineralization of bone and dentin. In this strain, Cre recombinase expression is under the control of Dmp1 promoter in a bone and tooth tissue pattern. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Dmp1 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Dmp1iCre primer 1 TGGAAGCTGACAGTAGGAAAC 56 WT: 334
Dmp1iCre primer 2 TGACATCATCCCACGTACTTAAGC 58
Dmp1iCre primer 1 TGGAAGCTGACAGTAGGAAAC 56 Mut: 208
Dmp1iCre primer 3 TGGTGCACAGTCAGCAGGTTG 61

Polymerase: Taq

 

 

 

References

1. Lu Y; Xie Y; Zhang S; Dusevich V; Bonewald LF; Feng JQ. 2007. DMP1-targeted Cre
expression in odontoblasts and osteocytes. J Dent Res 86(4):320-5. [PubMed: 17384025]
2. Li C,  Xie X , Wang X, Sun Y, Liu P, Chen L, Qin C. 2013. Differential expression and
localization of dentin matrix protein 1 (DMP1) fragments in mouse submandibular glands.
Endocrinology J Mol Histol. [PubMed: 23111467]

Back to top