B-Drd1-Cre Rats

Basic Information

Strain Name
SD-Drd1 tm1(Cre) /Bcgen
Stock Number
B-CR-002
Common Name
B-Drd1-Cre Rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Drd1 (dopamine receptor D1); D1a; Drd-1; Drd1a
Species
Sprague Dawley
Appearance
White
Genotypes
Drd1 Cre (wt/mut)
Development
A P2A-NLS-Cre sequence cassette was placed between the coding sequence of exon 3 and 3’UTR of the Drd1 gene usingCRISPR/Cas9technology. This strain was maintained on a Sprague Dawley genetic background.

Description

The Drd1 gene encodes dopamine receptor D1. In this strain, Cre recombinase expression is under the control of Drd1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Drd1 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Drd1 Cre primer 1 ATGCTACAGACTCTGCCCTACTACG 62 WT:772
Drd1 Cre primer 2 GAATCCCACTCCTGCTGTAAGGCTC 58
Drd1 Cre primer 3 ATGCTACAGACTCTGCCCTACTACG 62 Mut:483
Drd1 Cre primer 1 CGATCCCTGAACATGTCCATCAG 60

Polymerase: Kod-plus

 

 

 

 

References

1. Sarinana J; Kitamura T; Kunzler P; Sultzman L; Tonegawa S. 2014. Differential roles of the dopamine 1-class receptors, D1R and D5R, in hippocampal dependent memory. Proc Natl Acad Sci U S A 111(22):8245-50. [PubMed: 24843151]
2. Bermak, J. C., Li, M., Bullock, C., Zhou, Q.-Y. Regulation of transport of the dopamine D1
receptor by a new membrane-associated ER protein. Nature Cell Biol. 3: 492-498, 2001.
[PubMed: 11331877]
3. Huang, W., Ma, J. Z., Payne, T. J., Beuten, J., Dupont, R. T., Li, M. D. Significant
association of DRD1 with nicotine dependence. Hum. Genet. 123: 133-140, 2008. [PubMed: 18092181]
4.Zhou, Q.Y., Grandy, D. K., Thambi, L., Kushner, J. A., Van Tol, H. H. M., Cone, R., Pribnow, D., Salon, J., Bunzow, J. R., Civelli, O. Cloning and expression of human and rat D(1) dopamine receptors. Nature 347: 76-80, 1990. [PubMed: 2168520]
5. Parker KL, Chen KH, Kingyon JR, Cavanagh JF, Narayanan NS. 2014. D1-dependent 4 Hz oscillations and ramping activity in rodent medial frontal cortex during interval timing. J Neurosci. 10;34(50):16774-83. [PubMed: 25505330]

Back to top