Basic Information

Strain Name
C57BL/6-F8 tm1 /Bcgen
Stock Number
B-EM-007
Common Name
B-F8 KO Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
F8;FVIII(coagulation factor VIII)
Species
C57BL/6
Appearance
Black
Genotypes
Heterozygote
Development
The B-F8 KO mice were developed by Beijing Biocytogen Co., Ltd. The Exons 16-20 of mice were knocked out.

Description

This gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. This gene produces two alternatively spliced transcripts. Transcript variant 1 encodes a large glycoprotein, isoform a, which circulates in plasma and associates with von Willebrand factor in a noncovalent complex. This protein undergoes multiple cleavage events. Transcript variant 2 encodes a putative small protein, isoform b, which consists primarily of the phospholipid binding domain of factor VIIIc. This binding domain is essential for coagulant activity. Defects in this gene results in hemophilia A, a common recessive X- linked coagulation disorder.

Targeting Strategy

B-F8-KO-mice-Targeting-Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product size
(bp)
F8-WT-F ACTGTGGCTGGGTGTAGTAGCAC 63 WT: 356
F8-WT-R TTTCTCCAAGTTGCAGGTCAAGGCT 60
F8-WT-F ACTGTGGCTGGGTGTAGTAGCAC 63 Mut: ~400
WT: 5925
F8-Mut-R CGCATAATACACCCTGGTCACACTCAC 63

Polymerase: Taq

Application

NovoSeven efficacy evaluation

B-F8-KO-mice-NovoSeven efficacy evaluation

Animals were randomly divided into Control group or NovoSeven (1 mg/kg), After 30 minutes treatment, the abdominal aorta was collected blood for ATPP (activated partial thromboplastin time) detection. The results showed that the APTT recovered to normal after drug treatment compared with the control group.

 

References

1. Nat Genet. 1995 May;10(1):119-21.
2. Blood. 2014 Jun 12;123(24):3706-13. doi: 10.1182/blood-2014-02-555151. Epub
2014 Apr 4.

Back to top