Basic Information

Strain Name
C57BL/6-F9 tm1 /Bcgen
Stock Number
B-EM-008
Common Name
B-F9 KO Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
F9;FIX(coagulation factor IX)
Species
C57BL/6
Appearance
Black
Genotypes
Heterozygote
Development
The B-F9 KO mice were developed by Beijing Biocytogen Co., Ltd. The Exons 1-3 of mice were knocked out.

Description

This gene encodes vitamin K-dependent coagulation factor IX that circulates in the blood as an inactive zymogen. This factor is converted to an active form by factor XIa, which excises the activation peptide and thus generates a heavy chain and a light chain held together by one or more disulfide bonds. The role of this activated factor IX in the blood coagulation cascade is to activate factor X to its active form through interactions with Ca2+ ions, membrane phospholipids, and factor VIII. Alterations of this gene, including point mutations, insertions and deletions, cause factor IX deficiency, which is a recessive X-linked disorder, also called hemophilia B or Christmas disease.

Targeting Strategy

B-F9-KO-mice-Targeting-Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
F9-Mut-F3 GGTACTGTGTACTGTTCCCAATTACAG
A
63 WT: 7049
Mut: 563
F9-Mut-R2 GAATTGGACCTCAGGTAGATGGAGC 63
F9-WT-F3 AACACGTTGCAGAAAGATCCTGTCA 63 WT: 474
F9-WT-R3 AAGTCAGCCTGTGAAATGTCCCTCA 64

Polymerase: Taq

Application

NovoSeven efficacy evaluation

B-F9-KO-mice-NovoSeven efficacy evaluation

Animals were randomly divided into Control group or NovoSeven (1 mg/kg), After 30 minutes treatment, the abdominal aorta was collected blood for ATPP (activated partial thromboplastin time) and FIB (Fibrinogen) detection. The results showed that the APTT recovered to normal after drug treatment compared with the control group. FIB values were not significantly different from WT mice. A:ATPP±SEM; B: FIB±SEM.

References

1. Blood. 1998 Jul 1;92(1):168-74
2. Proc Natl Acad Sci U S A. 1997 Oct 14;94(21):11563-6.

Back to top