B-Grpr-iCre Mice

Basic Information

Strain Name
C57BL/6-Grpr tm1(iCre) /Bcgen
Stock Number
B-EM-004
Common Name
B-Grpr-iCre Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Grpr (gastrin releasing peptide receptor); GRP-R
Species
C57BL/6
Appearance
Black
Genotypes
Grpr iCre (wt/mut)
Development
An F2A-iCre sequence cassette was placed between the coding sequence of exon 3 and 3’UTR of the Grpr gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Description

The human GRPR gene and its receptor in tumors suggest that these molecules are part of an autocrine loop for growth. The mouse Grpr is highly expressed both in the lateral nucleus of the amygdala, the nucleus where associations for pavlovian learned fear are formed, and in the regions that convey fearful auditory information to the lateral nucleus. In this strain, iCre recombinase expression is under the control of Grpr promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Grpr expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 WT: 213
Grpr iCre primer 2 CAATGGTGATTGGTGCATTTGGAC 59
Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 Mut: 244
Grpr iCre primer 3 CCTGTCCCTGAACATGTCCATCAG 61

Polymerase: Taq

 

 

References

1. Maslen, G. L., Boyd, Y. 1993. Comparative mapping of the Grpr locus on the X
chromosomes of man and mouse. Genomics 17: 106-109. [PubMed: 8406441]
2. Shumyatsky, G. P., Tsvetkov, E., Malleret, G., Vronskaya, S., Hatton, M., Hampton, L.,
Battey, J. F., Dulac, C., Kandel, E. R., Bolshakov, V. Y. 2002. Identification of a signaling network in lateral nucleus of amygdala important for inhibiting memory specifically related to learned fear. Cell 111: 905-918. [PubMed: 12526815]
3. Sun, Y.-G., Zhao, Z.-Q., Meng, X.-L., Yin, J., Liu, X.-Y., Chen, Z.-F. Cellular basis of itch
sensation. Science 325: 1531-1534, 2009. [PubMed: 19661382]

Back to top