B-Kit-CreERT2 Rats

Basic Information

Strain Name
SD-Kit tm1(CreERT2) /Bcgen
Stock Number
B-CR-004
Common Name
B-Kit-CreERT2 rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Kit (v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog)
Species
Sprague Dawley
Appearance
White
Genotypes
Kit CreERT2 (wt/mut)
Development
A F2A-CreERT2 sequence cassette was placed between the coding sequence of exon 21 and 3’UTR of the Kit gene using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background.

Description

The Kit gene encodes the tyrosine kinase receptor KIT, KIT and its ligand, KITLG, function in hematopoiesis, melanogenesis, and gametogenesis. In this strain, Cre recombinase expression is under the control of Kit promoter. When crossed with a strain containing a loxP site-flanked sequence of interest and treated with tamoxifen, Cre-mediated recombination results in deletion of the flanked sequence in Kit expressing cells.

Targeting Strategy

 

 

 

 

 

Details

Genotyping Information

Primer Sequence (5’-3’) Tm

(℃)

Product size (bp)
Kit CreERT2 -primer1 AGCTAGTGCTTGCTTTCAGACACACC 65 Mut: 532
Kit CreERT2 -primer2 CGATCCCTGAACATGTCCATCAG 61
Kit CreERT2 -primer3 GTACAGCATGAAGTGCAAGAACGTGG 64 Mut: 549
Kit CreERT2 -primer4 CGATCTCGAGACTGTGAAGAACTCCAGGCATCC 64
Kit CreERT2 -primer1 AGCTAGTGCTTGCTTTCAGACACACC 65 Mut: 2749
WT: 611
Kit CreERT2 -primer4 CGATCTCGAGACTGTGAAGAACTCCAGGCATCC 64

Polymerase: Kod-plus

 

References

  1. Das AV, James J, Zhao X, Rahnenführer J, Ahmad I. 2004. Identification of c-Kit receptor as a regulator of adult neural stem cells in the mammalian eye: interactions with Notch signaling. Dev Biol. 1;273(1):87-105. [PubMed: 15302600]
    2. Albertí E, Mikkelsen HB, Wang XY, Díaz M, Larsen JO, Huizinga JD, Jiménez M. 2007. Tau suppression in a neurodegenerative mouse model improves memory function. Am J Physiol Gastrointest Liver Physiol. 292(6): G1499-510. [PubMed: 17322067]
    3. Biermann K, Göke F, Nettersheim D, Eckert D, Zhou H, Kahl P, Gashaw I, Schorle H, Büttner R. 2007. c-KIT is frequently mutated in bilateral germ cell tumours and down-regulated during progression from intratubular germ cell neoplasia to seminoma. J Pathol.
    213(3):311-8. [PubMed: 17768701]
    4. Maffini MV, Soto AM, Sonnenschein C, Papadopoulos N, Theoharides TC. 2008. Lack of c-kit receptor promotes mammary tumors in N-nitrosomethylurea-treated Ws/Ws rats. Cancer Cell Int. 29; 8:5. [PubMed: 18445266]
    5. Jeong HJ, Choi Y, Kim KY, Kim MH, Kim HM. 2011. C-kit binding properties of hesperidin (a major component of KMP6) as a potential anti-allergic agent. PLoS One. 29; 6(4): e19528. [PubMed: 21559359]
Back to top