B-Myh6-CreERT2 Rats

Basic Information

Strain Name
SD-Myh6tm1(Cre/ERT2)/Bcgen
Stock Number
B-CR-018
Common Name
B-Myh6-CreERT2 rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Myh6 (myosin heavy chain 6)
Species
Sprague Dawley
Appearance
White
Genotypes
Myh6CreERT2 (wt/mut)
Development
A P2A-CreERT2 sequence cassette was placed between the coding sequence of exon 38 and 3’UTR of the Myh6 gene using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background.

Description

The Myh6 gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. In this strain, Cre recombinase expression is under the control of Myh6 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Myh6 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product size (bp)
Myh6-MSD-F AGACTCCTGAGGTTTAACTCCTCCC 63 Mut:1567
Myh6-L-GT-R CATCAGGATCTCTAGCCAGGCACATTC 63
Myh6-R-GT-F GCTGGAGACATGAGAGCTGCCAACC 65 Mut:1278
Myh6-MSD-R ATGAGGCTTGGCCATCCATTATACC 63
Myh6-MSD-F AGACTCCTGAGGTTTAACTCCTCCC 63 WT:475
Myh6-MSD-R ATGAGGCTTGGCCATCCATTATACC 63

Polymerase: KOD FX

References

  1. Buckingham, M., Alonso, S., Barton, P., Cohen, A., Daubas, P., Garner, I., Robert, B., Weydert, A.Actin and myosin multigene families: their expression during the formation and maturation of striated muscle. Am. J. Med. Genet. 25: 623-634, 1986. [PubMed: 3789022, related citations]
  2. Carniel, E., Taylor, M. R. G., Sinagra, G., Di Lenarda, A., Ku, L., Fain, P. R., Boucek, M. M., Cavanaugh, J., Miocic, S., Slavov, D., Graw, S. L., Feiger, J., Zhu, X. Z., Dao, D., Ferguson, D. A., Bristow, M. R., Mestroni, L. Alpha-myosin heavy chain: a sarcomeric gene associated with dilated and hypertrophic phenotypes of cardiomyopathy. Circulation 112: 54-59, 2005. [PubMed: 15998695, related citations]
  3. Ching, Y.-H., Ghosh, T. K., Cross, S. J., Packham, E. A., Honeyman, L., Loughna, S., Robinson, T. E., Dearlove, A. M., Ribas, G., Bonser, A. J., Thomas, N. R., Scotter, A. J., Caves, L. S. D., Tyrrell, G. P., Newbury-Ecob, R. A., Munnich, A., Bonnet, D., Brook, J. D. Mutation in myosin heavy chain 6 causes atrial septal defect. Nature Genet. 37: 423-428, 2005. [PubMed: 15735645, related citations]
  4. Edwards, Y. H., Parkar, M., Povey, S., West, L. F., Parrington, J. M., Solomon, E. Human myosin heavy chain genes assigned to chromosome 17 using a human cDNA clone as probe. Ann. Hum. Genet. 49: 101-109, 1985. [PubMed: 3000272, related citations]
  5. Epp, T. A., Dixon, I. M. C., Wang, H.-Y., Sole, M. J., Liew, C.-C. Structural organization of the human cardiac alpha-myosin heavy chain gene (MYH6). Genomics 18: 505-509, 1993. [PubMed:8307559, related citations]
  6. Geisterfer-Lowrance, A. A. T., Kass, S., Tanigawa, G., Vosberg, H.-P., McKenna, W., Seidman, C. E., Seidman, J. G. A molecular basis for familial hypertrophic cardiomyopathy: a beta cardiac myosin heavy chain gene missense mutation. Cell 62: 999-1006, 1990. [PubMed: 1975517, related citations]
  7. Hang, C. T., Yang, J., Han, P., Cheng, H.-L., Shang, C., Ashley, E., Zhou, B., Chang, C.-P. Chromatin regulation by Brg1 underlies heart muscle development and disease. Nature 466: 62-67, 2010. Note: Erratum: Nature 475: 532 only, 2011. [PubMed: 20596014, images, related citations]
  8. Holm, H., Gudbjartsson, D. F., Sulem, P., Masson, G., Helgadottir, H., Zanon, C., Magnusson, O., Helgason, A., Saemundsdottir, J., Gylfason, A., Stefansdottir, H., Gretarsdottir, S., and 18 others. A rare variant in MYH6 is associated with high risk of sick sinus syndrome. Nature Genet. 43: 316-320, 2011. [PubMed: 21378987, images, related citations]
Back to top