B-Ncr1 (Nkp46)-iCre Mice

Basic Information

Strain Name
C57BL/6-Ncr1tm1(iCre)/Bcgen
Stock Number
B-EM-006
Common Name
B-Ncr1 (Nkp46)-iCre Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Ncr1 (natural cytotoxicity triggering receptor 1); Ly94; NKp46
Species
C57BL/6
Appearance
Black
Genotypes
Ncr1 (wt/mut)
Development
An IRES-iCre sequence cassette was placed between the coding sequence of exon 7 and 3’UTR of the Nkp46 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at least 300bp downstream of 3’UTR. This strain was maintained on a C57BL/6 genetic background.

Description

The Ncr1 gene, also called Nkp46, encodes the natural cytotoxicity triggering receptor 1. This protein is expressed specifically in natural killer (NK) cells and possibly in related innate lymphocytes. In this strain, Cre recombinase expression is under the control of Ncr1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Ncr1 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 WT: 285
Ncr1 iCre primer 2 CTTTGCCAAACTTGGTAACACTCC 58
Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 Mut: 282
Ncr1 iCre primer 3 CACACCGGCCTTATTCCAAG 57

Polymerase: Taq

References

1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H;
Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor
immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012.
Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]

Back to top