B-Nphs2 (podocin)-CreERT2 Rats

Basic Information

Strain Name
SD-Nphs2tm1(CreERT2)/Bcgen
Stock Number
B-CR-005
Common Name
B-Nphs2 (podocin)-CreERT2 rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Nphs2(nephrosis 2, idiopathic, steroid-resistant); podocin
Species
Sprague Dawley
Appearance
White
Genotypes
Nphs2CreERT2 (wt/mut)
Development
A F2A-CreERT2 sequence cassette was placed between the coding sequence of exon 8 and 3’UTR of the Nphs2 gene using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background.

Description

The Nphs2 gene encodes podocin, a protein that is expressed at the insertion of the slit diaphragm in the renal glomerulus. Podocytes are specialized epithelial cells covering the basement membrane of the renal glomerulus, and they mediate glomerular filtration through the slit diaphragm. Podocin is thus crucial in the establishment of the glomerular filtration barrier. In this strain, Cre recombinase expression is under the control of Nphs2 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Nphs2 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm

(℃)

Product size (bp)
Nphs2CreERT2 primer 1 GCCTTTACCCTTTGACATGCTG 58 WT:604
Nphs2CreERT2 primer 2 CGATCCCTGAACATGTCCATCAG 59
Nphs2CreERT2 primer 3 GCCCAAGTTTAACAATGCCTGGCTC 60 Mut:594
Nphs2CreERT2 primer 4 GTGGCTGGATGTCTTCTCTGCCATT 59

Polymerase: Taq

 

 

 

 

 

 

References

  1. Moeller MJ; Sanden SK; Soofi A; Wiggins RC; Holzman LB. 2003. Podocyte-specific expression of cre recombinase in transgenic mice. Genesis 35(1):39-42. [PubMed: 12481297]
  2. Arora S; Husain M; Kumar D; Patni H; Pathak S; Mehrotra D; Reddy VK; Reddy LR; Salhan D; Yadav A; Mathieson PW; Saleem MA; Chander PN; Singhal PC. 2009. Human immunodeficiency virus downregulates podocyte apoE expression. Am J Physiol Renal Physiol 297(3):F653-61. [PubMed: 19553347]
  3. Blattner SM; Hodgin JB; Nishio M; Wylie SA; Saha J; Soofi AA; Vining C; Randolph A; Herbach N; Wanke R; Atkins KB; Gyung Kang H; Henger A; Brakebusch C; Holzman LB; Kretzler M. 2013. Divergent functions of the Rho GTPases Rac1 and Cdc42 in podocyte injury. Kidney Int 84(5):920-30. [PubMed: 23677246]
  4. Bollee G; Flamant M; Schordan S; Fligny C; Rumpel E; Milon M; Schordan E; Sabaa N; Vandermeersch S; Galaup A; Rodenas A; Casal I; Sunnarborg SW; Salant DJ; Kopp JB; Threadgill DW; Quaggin SE; Dussaule JC; Germain S; Mesnard L; Endlich K; Boucheix C; Belenfant X; Callard P; Endlich N; Tharaux PL. 2011. Epidermal growth factor receptor promotes glomerular injury and renal failure in rapidly progressive crescentic glomerulonephritis. Nat Med 17(10):1242-50. [PubMed: 21946538]
  5. Pan QR, Ren YL, Zhu JJ, Hu YJ, Zheng JS, Fan H, Xu Y, Wang G, Liu WX. 2014. Resveratrol increases nephrin and podocin expression and alleviates renal damage in rats fed a high-fat diet. Nutrients. 14;6(7):2619-31. [PubMed: 25025298]
Back to top