B-Oxr1-iCreERT2 Mice

Basic Information

Strain Name
C57BL/6-Oxr1 tm1(iCre/ERT2) /Bcgen
Stock Number
B-CM-003
Common Name
B-Oxr1-iCreERT2 Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Oxr1 (oxidation resistance 1); C7; C7B; 2210416C20Rik
Species
C57BL/6
Appearance
Black
Genotypes
Oxr1 iCreERT2 (wt/mut)
Development
A F2A-iCreERT2 sequence cassette was placed between the coding sequence of exon 17 and 3’UTR of the Oxr1 gene using CRISPR/Cas9 technology. This strain was maintained on a C57BL/6 genetic background.

Description

The Oxr1 gene, encoding oxidation resistance 1, is a member of a conserved family of genes found in eukaryotes but not in prokaryotes. In this strain, Cre recombinase expression is under the control of Oxr1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest and treated with tamoxifen, Cre-mediated recombination results in deletion of the flanked sequence in Oxr1 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Oxr1 iCreERT2 primer 1 AGAGAAGTTTATGGCCTGGAGCTAG 62 WT: 682
Oxr1 iCreERT2 primer 2 ATGTCACCTGTGCCAACTCCACC 60
Oxr1 iCreERT2 primer 3 GTACAGCATGAAGTGCAAGAACGTGG 60 Mut: 1277
Oxr1 iCreERT2 primer 4 ACTTGACAGTAAGCTTGCACATTCACC 60

Polymerase: KOD-FX

 

 

 

References

1. Li Y, Li W, Liu C, Yan M, Raman I, Du Y, Fang X, Zhou XJ, Mohan C, Li QZ. 2014.
Delivering Oxidation Resistance-1 (OXR1) to Mouse Kidney by Genetic Modified
Mesenchymal Stem Cells Exhibited Enhanced Protection against Nephrotoxic Serum Induced Renal Injury and Lupus Nephritis. J Stem Cell Res Ther. 10;4(9). [PubMed: 25995969]
2. Yang M, Luna L, Sørbø JG, Alseth I, Johansen RF, Backe PH, Danbolt NC, Eide L, Bjørås M. 2014. Human OXR1 maintains mitochondrial DNA integrity and counteracts hydrogen peroxide-induced oxidative stress by regulating antioxidant pathways involving p21. Free Radic Biol Med. Dec; 77:41-8. [PubMed: 25236744]
3. Kobayashi N, Takahashi M, Kihara S, Niimi T, Yamashita O, Yaginuma T. 2014. Cloning of
cDNA encoding a Bombyx mori homolog of human oxidation resistance 1 (OXR1) protein
from diapause eggs, and analyses of its expression and function. J Insect Physiol. 68:58-68. [PubMed: 25010546]
4. Finelli MJ, Liu KX, Wu Y, Oliver PL, Davies KE. 2015. Oxr1 improves pathogenic cellular
features of ALS-associated FUS and TDP-43 mutations. Hum Mol Genet. 15;24(12):3529-44. [PubMed: 25792726]
5. Aracri P, Banfi D, Pasini ME, Amadeo A, Becchetti A. 2015. Hypocretin (orexin) regulates glutamate input to fast-spiking interneurons in layer V of the Fr2 region of the murine prefrontal cortex. Cereb Cortex. 25(5):1330-47. [PubMed: 24297328]

Back to top