B-Pdgfrb-iCre Mice

Basic Information

Strain Name
C57BL/6- Pdgfrb tm1(iCre) /Bcgen
Stock Number
B-CM-004
Common Name
B-Pdgfrb-iCre Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Pdgfrb (platelet derived growth factor receptor, beta polypeptide); CD140b
Species
C57BL/6
Appearance
Black
Genotypes
Pdgfrb iCre (wt/mut)
Development
An F2A-iCre sequence cassette was placed between the coding sequence of exon 23 and 3’UTR of the Pdgfrb gene using CRISPR/Cas9 technology. This strain was maintained on a C57BL/6 genetic background.

Description

The Pdgfrb gene encodes a cell surface tyrosine kinase receptor, the beta- type platelet-derived growth factor receptor. In this strain, codon optimized Cre recombinase expression is under the control of Pdgfrb promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, iCre-mediated recombination results in deletion of the flanked sequence in Pdgfrb expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Pdgfrb-primer 1 TCTTCCCGCTCTCAAGTTCTAGC 59 Mut: 595
Pdgfrb-primer 2 GCACACAGACAGGAGCATCTTC 59
Pdgfrb-primer 1 TCTTCCCGCTCTCAAGTTCTAGC 59 WT: 411
Mut: 1533
Pdgfrb-primer 3 GTTCTGGGAGGCAGAAGGGAGATTC 61

Polymerase: Taq

 

 

 

References

1. Olson LE; Soriano P. 2011. PDGFRbeta Signaling Regulates Mural Cell Plasticity and
Inhibits Fat Development. Dev Cell 20(6):815-26. [PubMed: 21664579]
2. Chhabra A; Lechner AJ; Ueno M; Acharya A; Van Handel B; Wang Y; Iruela-Arispe ML;
Tallquist MD; Mikkola HK. 2012. Trophoblasts regulate the placental hematopoietic niche through PDGF-B signaling. Dev Cell 22(3):651-9. [PubMed: 22387002]
3. Hellstrom M; Kal n M; Lindahl P; Abramsson A; Betsholtz C. 1999. Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse. Development 126(14):3047-55. [PubMed: 10375497]
4. Klinghoffer RA; Mueting-Nelsen PF; Faerman A; Shani M; Soriano P. 2001. The two PDGF receptors maintain conserved signaling in vivo despite divergent embryological functions. Mol Cell 7(2):343-54. [PubMed: 11239463]
5. Lindahl P; Hellstrom M; Kalen M; Karlsson L; Pekny M; Pekna M; Soriano P; Betsholtz C.
1998. Paracrine PDGF-B/PDGF-Rbeta signaling controls mesangial cell development in kidney glomeruli. Development 125(17):3313-22. [PubMed: 9693135]

Back to top