B-Prrx1-iCre Mice

Basic Information

Strain Name
C57BL/6-Prrx1 tm1(iCre) /Bcgen
Stock Number
B-EM-007
Common Name
B-Prrx1-iCre mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Prrx1 (paired related homeobox 1); K-2; Pmx; Pmx1; Prx1; mHox; AA755424; AI385634; AI843499; A230024N07Rik
Species
C57BL/6
Appearance
Black
Genotypes
Prrx1 iCre (wt/mut)
Development
An F2A-iCre sequence cassette was placed between the coding sequence of exon 1 and 5’UTR of the Prrx1 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Description

The Prrx1 gene encodes a DNA-associated protein, paired related homeobox 1, localized to the nucleus and functions as a transcription coactivator. This protein regulates muscle creatine kinase, and differentiation of mesenchymal precursors. Prrx1 expression is restricted to the mesoderm during embryonic development and mesenchymal tissues in adult mice. In this strain, Cre recombinase expression is under the control of Prrx1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Prrx1 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Prrx1 iCre primer 1 AGCGTTTGGTGTTGATTCGAGC 60 WT: 267
Prrx1 iCre primer 2 AGTCCCGGTGACTCCAGCAG 62
Prrx1 iCre primer 1 AGCGTTTGGTGTTGATTCGAGC 62 Mut: 108
Prrx1 iCre primer 3 TGGTGCACAGTCAGCAGGTTG 61

Polymerase: Taq

 

 

 

 

 

References

1. Durland JL; Sferlazzo M; Logan M; Burke AC. 2008. Visualizing the lateral somitic frontier
in the Prx1Cre transgenic mouse. J Anat 212(5):590-602. [PubMed: 18430087] [MGI Ref ID J:209265]
2. Seo HS; Serra R. 2007. Deletion of Tgfbr2 in Prx1-cre expressing mesenchyme results in
defects in development of the long bones and joints. Dev Biol 310(2):304-16. [PubMed:
17822689] [MGI Ref ID J:128010]

Back to top