Basic Information

Strain Name
SD-Rag2tm1/Bcgen
Stock Number
B-TR-007
Common Name
B-Rag2 KO Rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Rag2 (recombination activating gene 2)
Species
Sprague Dawley
Appearance
White
Genotypes
Rag2KO (mut/mut)
Development
The Rag2KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses a 121 bp deletion within Exon 3 on chromosome 3. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.

Description

The recombinant-activating gene 2 (Rag2) plays an important role in the rearrangement and recombination of the genes of immunoglobulin and T cell receptor molecules during the initiation of V(D)J recombination. Loss of Rag2 protein leads to no mature T and B cells, the critical components of the adaptive immune system.

Targeting Strategy

B-Rag2-KO-Rats-targeting-strategy

Details

Genotyping Information

 

Primer Sequence (5’-3’) Tm

()

Product size (bp)
Rag2KO primer 1 CCTCGGATTCTCAAAGCAAGGG 62 Mut: 881

WT: 1002

Rag2KO primer 2 CAGGACGTATGTTACTGGCAAGTG 62

Polymerase: Taq

The fragments need to be verified by sequencing.

References

  1. Corneo, B., et al., Identical mutations in RAG1 or RAG2 genes leading to defective V(D)J recombinase activity can cause either T-B-severe combined immune deficiency or Omenn syndrome. Blood, 2001. 97(9): p. 2772-6. [PubMed: 11313270]
  2. Shinkai, Y., et al., RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell, 1992. 68(5): p. 855-67. [PubMed: 1547487]
  3. Rideout, W.M., 3rd, et al., Correction of a genetic defect by nuclear transplantation and combined cell and gene therapy. Cell, 2002. 109(1): p. 17-27. [MGI Ref ID J:11955443]
Back to top