B-Slc6a2-Cre Rats

Basic Information

Strain Name
SD-Slc6a2 tm1 (Cre) /Bcgen
Stock Number
B-CR-007
Common Name
B-Slc6a2-Cre rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Slc6a2 (solute carrier family 6 (neurotransmitter transporter), member 2); Net
Species
Sprague Dawley
Appearance
White
Genotypes
Slc6a2Cre (wt/mut)
Development
A F2A-Cre sequence cassette was placed between the coding sequence of exon 14 and 3’UTR of the Slc6a2 gene using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background.

Description

The Slc6a2 gene encodes a norepinephrine (noradrenaline) transporter, which is responsible for reuptake of norepinephrine into presynaptic nerve terminals and is a regulator of norepinephrine homeostasis. In this strain, Cre recombinase expression is under the control of Slc6a2 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Slc6a2 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm

()

Product size (bp)
Slc6a2Cre primer 1 CTTTGTGCTAAAGCCACAATGAAGC 59 Mut:1322

WT:617

Slc6a2Cre primer 2 GTTCAATGACCCGACAGAGTGAAAG 59
Slc6a2Cre primer 1 CTTTGTGCTAAAGCCACAATGAAGC 59 Mut:368
Slc6a2Cre primer 3 CGATCCCTGAACATGTCCATCAG 58

Polymerase: Kod-plus

 

 

References

  1. Wehrwein EA, Novotny M, Swain GM, Parker LM, Esfahanian M, Spitsbergen JM, Habecker BA, Kreulen DL. 2013. Regional changes in cardiac and stellate ganglion norepinephrine transporter in DOCA-salt hypertension. AutonNeurosci. 179(1-2):99-107. [PubMed: 24075956]
  2. Jayanthi LD, Samuvel DJ, Ramamoorthy S. 2004. Regulated internalization and phosphorylation of the native norepinephrine transport r in response to phorbol esters. Evidence for localization in lipid rafts and lipid raft-mediated internalization. J Biol Chem. 30;279(18):19315-26. [PubMed: 24075956]
  3. Kitayama S, Ikeda T, Mitsuhata C, Sato T, Morita K, Dohi T. 1999. Dominant negative isoform of rat norepinephrine transporter produced by alternative RNA splicing. J Biol Chem. 16;274(16):10731-6. [PubMed: 12495625]
  4.  Shannon, J. R., Flattem, N. L., Jordan, J., Jacob, G., Black, B. K., Biaggioni, I., Blakely, R. D., Robertson, D. Orthostatic intolerance and tachycardia associated with norepinephrine-transporter deficiency. New Eng. J. Med. 342: 541-549, 2000. [PubMed: 10684912]
  5. Zhou, Z., Zhen, J., Karpowich, N. K., Goetz, R. M., Law, C. J., Reith, M. E. A., Wang, D.-N. LeuT-desipramine structure reveals how antidepressants block neurotransmitter reuptake. Science 317: 1390-1393, 2007. [PubMed: 17690258]
Back to top