B-Slc6a3 (Dat1)-Cre Rats

Basic Information

Strain Name
SD-Slc6a3tm1(Cre)/Bcgen
Stock Number
B-CR-008
Common Name
B-Slc6a3 (Dat1)-Cre rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Related Genes: Slc6a3 (solute carrier family 6 (neurotransmitter transporter, dopamine), member 3); Dat1
Species
Sprague Dawley
Appearance
White
Genotypes
Slc6a3Cre (wt/mut)
Development
A F2A-Cre sequence cassette was placed between the coding sequence of exon 15 and 3’UTR of the Slc6a3 gene using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background

Description

The Slc6a3 gene encodes the dopamine transporter (DAT), which mediates the active reuptake of dopamine from the synapse and is a principal regulator of dopaminergic neurotransmission. In this strain, Cre recombinase expression is under the control of Slc6a3 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Slc6a3 expressing cells

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm

()

Product size (bp)
Slc6a3Cre primer 1 TCACCTAATCATCTGCTTCTACCGG 59 Mut:1465
Slc6a3Cre primer 2 ACCGCGCGCCTGAAGATATAGAAG 62 Mut:1176
Slc6a3Cre primer 3 GATTTACGGCGCTAAGGATGACTCTGG 62
Slc6a3Cre primer 4 CATTGATGTGACAGGAGCCAGTAGG 60
Slc6a3Cre primer 1 TCACCTAATCATCTGCTTCTACCGG 59 Mut:3207

WT:2112

Slc6a3Cre primer 4 CATTGATGTGACAGGAGCCAGTAGG 60

Polymerase: KOD-plus

 

References

  1. Backman CM; Malik N; Zhang Y; Shan L; Grinberg A; Hoffer BJ; Westphal H; Tomac AC. 2006. Characterization of a mouse strain expressing Cre recombinase from the 3′ untranslated region of the dopamine transporter locus. Genesis 44(8):383-90. [PubMed: 16865686]
  2. Womersley JS, Hsieh JH, Kellaway LA, Gerhardt GA, Russell VA. 2011. Maternal separation affects dopamine transporter function in the spontaneously hypertensive rat: an in vivo electrochemical study. Behav Brain Funct. 1; 7:49. [PubMed: 22133315]
  3. Adriani W1, Boyer F, Gioiosa L, Macrì S, Dreyer JL, Laviola G. 2009. Neuroscience. Increased impulsive behavior and risk proneness following lentivirus-mediated dopamine transporter over-expression in rats’ nucleus accumbens. 3;159(1):47-58. [PubMed: 19135135]
  4. Berthet A; Margolis EB; Zhang J; Hsieh I; Zhang J; Hnasko TS; Ahmad J; Edwards RH; Sesaki H; Huang EJ; Nakamura K. 2014. Loss of mitochondrial fission depletes axonal mitochondria in midbrain dopamine neurons. J Neurosci 34(43):14304-17. [PubMed: 25339743]
  5. Hess ME; Hess S; Meyer KD; Verhagen LA; Koch L; Bronneke HS; Dietrich MO; Jordan SD; Saletore Y; Elemento O; Belgardt BF; Franz T; Horvath TL; Ruther U; Jaffrey SR; Kloppenburg P; Bruning JC. 2013. The fat mass and obesity associated gene (Fto) regulates activity of the dopaminergic midbrain circuitry. Nat Neurosci 16(8):1042-8. [PubMed: 23817550]
Back to top