B-Syn1-iCre Mice

Basic Information

Strain Name
C57BL/6-Syn1 tm1(iCre) /Bcgen
Stock Number
B-CM-005
Common Name
B-Syn1-iCre mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Syn1 (synapsin I); Syn-1; Syn1-S
Species
C57BL/6
Appearance
Black
Genotypes
Syn1 iCre (wt/mut)
Development
A F2A-iCre sequence cassette was placed between the coding sequence of exon 13 and 3’UTR of the Syn1 geneusing CRISPR/Cas9technology. This strain was maintained on a C57BL/6 genetic background.

Description

The Syn1 gene encodes synapsin I, a neuronal phosphoprotein associated with the membranes of small synaptic vesicles. In this strain, Cre recombinase expression is under the control of Syn1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Syn1 expressing cells.

Targeting Strategy

B-Syn1-iCre-mice-Targeting-Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
Syn1 iCre primer 1 GGATCCACATTCGCCTCAGTCTCAGCTTC 63 Mut: 574
Syn1 iCre primer 2 GCACACAGACAGGAGCATCTTC 59
Syn1 iCre primer 3 TGTGTCCATCCCTGAAATCATGC 58 Mut: 486
Syn1 iCre primer 4 CTCGAGAGAGCTCCAGGAGAGGATTCGATG 61
Syn1 iCre primer 1 GGATCCACATTCGCCTCAGTCTCAGCTTC 63 Mut: 1821
WT: 699
Syn1 iCre primer 4 CTCGAGAGAGCTCCAGGAGAGGATTCGATG 61

Polymerase: KOD-FX

 

 

 

 

References

1. hin, L.-S., Li, L., Ferreira, A., Kosik, K. S., Greengard, P. Impairment of axonal development and of synaptogenesis in hippocampal neurons of synapsin I-deficient mice. Proc. Nat. Acad. Sci. 92: 9230-9234, 1995. [PubMed: 7568107]
2. Derry, J. M. J., Barnard, P. J. Physical linkage of the A-raf-1, properdin, synapsin I, and TIMP genes on the human and mouse X chromosomes. Genomics 12: 632-638, 1992.
[PubMed: 1572636]
3. Fassio, A., Patry, L., Congia, S., Onofri, F., Piton, A., Gauthier, J., Pozzi, D., Messa, M.,
Defranchi, E., Fadda, M., Corradi, A., Baldelli, P., and 9 others. SYN1 loss-of-function
mutations in autism and partial epilepsy cause impaired synaptic function. Hum. Molec. Genet. 20: 2297-2307, 2011. [PubMed:  21441247]
4. Garcia, C. C., Blair, H. J., Seager, M., Coulthard, A., Tennant, S., Buddles, M., Curtis, A., Goodship, J. A. Identification of a mutation in synapsin I, a synaptic vesicle protein, in a family with epilepsy. J. Med. Genet. 41: 183-187, 2004. [PubMed: 14985377, related citations]
5. Hedegaard C1, Kjaer-Sorensen K, Madsen LB, Henriksen C, Momeni J, Bendixen C, Oxvig C, Larsen K.. 2013. Porcine synapsin 1: SYN1 gene analysis and functional characterization of the promoter. FEBS Open Bio. 7;3:411-20. [PubMed: 24251104]

Back to top