B-Tdtomato cKI Rats

Basic Information

Strain Name
SD-Gt (ROSA)26Sor tm1(CAG-LSL-Tdtomato) /Bcgen
Stock Number
B-CR-011
Common Name
B-Tdtomato cKI rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Tdtomato fluorescent protein
Species
Sprague Dawley
Appearance:
White
Genotypes:
Tdtomato cKI (wt/mut)
Development:
A designed targeting sequence containing pCAG-loxP-3*STOP-loxP- Tdtomato-WPRE-bGHpA was inserted to the Rosa26 between exon1 and exon2 using CRISPR/Cas9 technology. This strain was maintained on a Sprague Dawley genetic background.

Description

These Tdtomato cKI rats knockin rats have a floxed-STOP cassette preventing expression of the downstream bicistronic sequence (Tdtomato). Although under control of a CAG promoter, widespread expression of Tdtomato is prevented by the STOP cassette. After exposure to Cre recombinase, expression of Tdtomato will be observed.

Targeting Strategy

Details

Genotyping Information

PrimerSequence (5’-3’)Tm
(℃)
Product size (bp)
Tdtomato cKI primer 1TTGTATTGGAGACAAGAAGCACTTGCTC60WT: 646
Tdtomato cKI primer 2TTGATAGGGCTGCAGAAGTGGGAG61WT: 646
Tdtomato cKI primer 1TTGTATTGGAGACAAGAAGCACTTGCTC60Mut: 429
Tdtomato cKI primer 3AGTCCCTATTGGCGTTACTATGG58Mut: 429

 

References

  1. Ma Y, Zhang X, Shen B, Lu Y, Chen W, Ma J, Bai L, Huang X, Zhang L. 2014. Generating rats with conditional alleles using CRISPR/Cas9.Cell Res. Jan;24(1):122-5. [PubMed: 24296780]
  2. Ma Y1, Ma J, Zhang X, Chen W, Yu L, Lu Y, Bai L, Shen B, Huang X, Zhang L. 2014. Generation of eGFP and Cre knockin rats by CRISPR/Cas9. FEBS J. Sep;281(17):3779-90. [PubMed: 24296780]
Back to top