B-Tnfrsf11a (RANK)-iCre Mice

Basic Information

Strain Name
C57BL/6-Tnfrsf11a tm1(iCre) /Bcgen
Stock Number
B-EM-009
Common Name
B-Tnfrsf11a (RANK)-iCre mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Tnfrsf11a (tumor necrosis factor receptor superfamily, member 11a, NF- κB activator); OFE; ODFR; Rank; Ly109; mRANK; TRANCE-R
Species
C57BL/6
Appearance
Black
Genotypes
Tnfrsf11a iCre (wt/mut)
Development
A F2A-iCre sequence cassette was placed between the coding sequence of exon 10 and 3’UTR of the Tnfrsf11a gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Description

The Tnfrsf11a gene encodes receptor activator of nuclear factor-kappa B (RANK), maps to the same region of chromosome 18 as familial expansile osteolysis. In this strain, Cre recombinase expression is under the control of Tnfrsf11a promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Tnfrsf11a expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Tnfrsf11a iCre primer 1 CCTGTGCAGGAGGAGACGCT 62 WT: 281
Tnfrsf11a iCre primer 2 GAGGTGCACAGTGGCTAGCT 60
Tnfrsf11a iCre primer 1 CCTGTGCAGGAGGAGACGCT 62 Mut: 317
Tnfrsf11a iCre primer 3 TGGTGCACAGTCAGCAGGTTG 61

Polymerase: Taq

 

 

 

 

 

References

1. Dougall, W. C., Glaccum, M., Charrier, K., Rohrbach, K., Brasel, K., De Smedt, T., Daro, E., Smith, J., Tometsko, M. E., Maliszewski, C. R., Armstrong, A., Shen, V., Bain, S., Cosman, D., Anderson, D., Morrissey, P. J., Peschon, J. J., Schuh, J. RANK is essential for osteoclast and lymph node development. Genes Dev. 13: 2412-2424, 1999. [PubMed: 10500098]
2. Gonzalez-Suarez, E., Jacob, A. P., Jones, J., Miller, R., Roudier-Meyer, M. P., Erwert, R.,
Pinkas, J., Branstetter, D., Dougall, W. C. RANK ligand mediates progestin-induced mammary epithelial proliferation and carcinogenesis. Nature 468: 103-107, 2010. [PubMed: 20881963, related citations]
3. Guerrini, M. M., Sobacchi, C., Cassani, B., Abinun, M., Kilic, S. S., Pangrazio, A., Moratto, D., Mazzolari, E., Clayton-Smith, J., Orchard, P., Coxon, F. P., Helfrich, M. H., and 9 others. Human osteoclast-poor osteopetrosis with hypogammaglobulinemia due to TNFRSF11A (RANK) mutations. Am. J. Hum. Genet. 83: 64-76, 2008. [PubMed: 18606301]
4. Li, J., Sarosi, I., Yan, X.-Q., Morony, S., Capparelli, C., Tan, H.-L., McCabe, S., Elliott, R., Scully, S., Van, G., Kaufman, S., Juan, S.-C., Sun, Y., Tarpley, J., Martin, L., Christensen, K., McCabe, J., Kostenuik, P., Hsu, H., Fletcher, F., Dunstan, C. R., Lacey, D. L., Boyle, W. J. RANK is the intrinsic hematopoietic cell surface receptor that controls osteoclastogenesis and regulation of bone mass and calcium metabolism. Proc. Nat. Acad. Sci. 97: 1566-1571, 2000.
[PubMed: 10677500]

Back to top