B-Zeb1-iCreERT2 Mice

Basic Information

Strain Name
C57BL/6-Zeb1 tm1(iCreERT2) /Bcgen
Stock Number
B-EM-011
Common Name
B-Zeb1-iCreERT2 mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Zeb1 (zinc finger E-box binding homeobox1); BZP; ZEB; MEB1; Nil2; Tcf8; delta-EF1
Species
C57BL/6
Appearance
Black
Genotypes
Zeb1 iCreERT2 (wt/mut)
Development
A F2A-iCreERT2 sequence cassette was placed between the coding sequence of exon 8 and 3’UTR of the Zeb1 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Description

The Zeb1 encodes a zinc finger transcription factor that expressed in the media of arteries and in cardiomyocytes. In this strain, CreERT2 recombinase expression is under the control of Zeb1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Zeb1 expressing cells.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
Zeb1 iCreERT2 primer 1 GTACAGTGGAGGTTGGAGCTGC 61 293
Zeb1 iCreERT2 primer 2 ACTAGGTTTGAGGTTCAGGCACAC 61
Zeb1 iCreERT2 primer 1 GTACAGTGGAGGTTGGAGCTGC 61 238
Zeb1 iCreERT2 primer 3 TGGTGCACAGTCAGCAGGTTG 61

Polymerase: Taq

 

 

 

References

  1. Nishimura G; Manabe I; Tsushima K; Fujiu K; OishiY; ImaiY; MaemuraK; MiyagishiM; HigashiY; KondohH; Nagai, R. Delta-EF1 mediates TGF-beta signaling in vascular smooth muscle cell differentiation. Dev. Cell 11: 93-104, 2006. [PubMed: 16824956]
    2. Nishimura, G., Manabe, I., Tsushima, K., Fujiu, K., Oishi, Y., Imai, Y., Maemura, K., Miyagishi, M., Higashi, Y., Kondoh, H., Nagai, R. Delta-EF1 mediates TGF-beta signaling in vascular smooth muscle cell differentiation. Dev. Cell 11: 93-104, 2006. [PubMed: 16824956]
    3. Krafchak, C. M., Pawar, H., Moroi, S. E., Sugar, A., Lichter, P. R., Mackey, D. A., Mian, S., Nairus, T., Elner, V., Schteingart, M. T., Downs, C. A., Kijek, T. G., and 9 others. Mutations in
    TCF8 cause posterior polymorphous corneal dystrophy and ectopic expression of COL4A3 by
    corneal endothelial cells. Am. J. Hum. Genet. 77: 694-708, 2005. [PubMed: 16252232]
    4. Williams, T. M., Moolten, D., Burlein, J., Romano, J., Bhaerman, R., Godillot, A., Mellon, M., Rauscher, F. J., III, Kant, J. A. Identification of a zinc finger protein that inhibits IL-2 gene
    expression. Science 254: 1791-1794, 1991. [PubMed: 1840704]
Back to top