B-Avp-iCre rats

Basic Information

Strain Name
SD-Avptm1(iCre)/Bcgen
Stock Number
210500
Common Name
B-Avp-iCre rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Avp (arginine vasopressin)
Species
SD Rat
Appearance
White

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm() Product size

(bp)

B-CR-024-WT-F GGTGAGTATGAAGGGGGTCGAGAGT 63 Mut:409
B-CR-024-Mut-R TGGTGCACAGTCAGCAGGTTG 62
B-CR-024-Mut-F GTGTGGCTGATGACCCCAACAACTA 60 Mut:594
B-CR-024-WT-R CCAGGAGCAGCAGAAGCTTCCTTTA 63
B-CR-024-WT-F GGTGAGTATGAAGGGGGTCGAGAGT 63 WT: 537

Mut:1662

B-CR-024-WT-R CCAGGAGCAGCAGAAGCTTCCTTTA 63

References

Dawood A F, Sabry M M, Estaphan S A, et al. Cross-talk between apelin and vasopressin in response to different osmotic stimuli in type 2 diabetic rats[J]. Journal of biological regulators and homeostatic agents, 2018, 32(5): 1117-1127.

Back to top