B-CAG-GFP cKI rats

Basic Information

Strain Name
SD-Gt(ROSA)26Sortm1(CAG-LSL-3XGFP)/Bcgen
Stock Number
B-CR-017
Common Name
B-CAG-GFP cKI rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
GFP fluorescent protein
Species
Sprague Dawley
Appearance
White
Genotypes
GFPcKI (wt/mut)
Development
A designed targeting sequence containing pCAG-loxP-3*STOP-loxP-3*GFP-WPRE-bGHpA was inserted to the Rosa26 between exon 1 and exon 2 using CRISPR/Cas9 technology.This strain was maintained on a Sprague Dawley genetic background.

Description

These GFPcK Irats knockin rats have a floxed-STOP cassette preventing expression of the downstream bicistronic sequence (3*GFP). Although under control of a CAG promoter, widespread expression of GFP is prevented by the STOP cassette. After exposure to Cre recombinase, expression of GFP will be observed.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5-3) Tm (℃) Product size (bp)
GFP cKI primer 1 TTGTATTGGAGACAAGAAGCACTTGCTC 60 WT: 646

Mut: 6583

GFP cKI primer 2 TTGATAGGGCTGCAGAAGTGGGAG 61
GFP cKI primer 3 TGCACTGTGTTTGCTGACGC 60 Mut: 230
GFP cKI primer 4 ATCCAGGTGGCAACACAGGC 62

Polymerase: Kod-FX

References

  1. Ma Y, Zhang X, Shen B, Lu Y, Chen W, Ma J, Bai L, Huang X, Zhang L. 2014. Generating rats with conditional alleles using CRISPR/Cas9. Cell Res. Jan;24(1):122-5. [PubMed: 24296780]
  2. Ma Y1, Ma J, Zhang X, Chen W, Yu L, Lu Y, Bai L, Shen B, Huang X, Zhang L. 2014. Generation of eGFP and Cre knockin rats by CRISPR/Cas9. FEBS J. Sep;281(17):3779-90. [PubMed: 24296780]
Back to top