B-CAG-iCreERT2 mice

Basic Information

Strain Name
C57BL/6-Gt(ROSA)26ortm6(CAG-iCre/ERT2)/Bcgen
Stock Number
110147
Common Name
B-CAG-iCreERT2 mice
Source/Investigator
Biocytogen Jiangsu Co., Ltd
Related Genes
ROSA26Sor、Cre
Species
C57BL/6
Appearance
Black
Genotypes
ROSA26SoriCre/ERT2 (wt/mut)

Description

This gene produces a long non-coding RNA (lncRNA) that is under the control of a constitutive promoter. This locus is a widely used site for the integration of transgenes and reporter constructs.

This CAG-iCreERT2 model is an efficient tool to study various gene functions when crossed with mice with different loxP site-flanked genes of interest, especially for time dependent gene expression.

Targeting strategy

Details

Genotyping Strategy

Genotyping PCR Primer

Primer Sequence (5’-3’) Tm (℃) Product Size (bp)
Primer-WT-F AGTCGCTCTGAGTTGTTATCAG 56 WT:469bp

Mut: 7103bp

Primer-WT-R TGAGCATGTCTTTAATCTACCTCGATG 58
Primer-Mut-F CTCTATGACCTGCTGCTGGAG 58 Mut:341bp
Primer-Mut-R ACGGGAAGCAATAGCATGATAC 57

PCR Reaction System

Reaction Component Volume(µL) Final Concentration
ddH2O 7
2x Taq Plus Master Mix(Dye Plus) 10
10 mM Primer-F 0.5 0.25 mM
10 mM Primer-R 0.5 0.25 mM
100-200 ng/mL Template DNA 2.0 10-20 ng/mL

PCR Steps

Step Temp. Time Cycles
1 94℃ 5 min 1
2 94℃ 30 s 30
3 61℃ 30 s
4 72℃  30 s
5 72℃ 10 min 1
6 4℃ hold 1

 Determination of Genotypes

Identification of Genotypes According to PCR Results

B-EM-006-WT-F

/B-EM-006-WT-R

B-EM-006-WT-F

/B-EM-006-Mut-R

Genotype
Mutation Wild Type Mutation
N* N Y Mut/Mut
N* Y Y Mut/+
N Y N +/+

N*: PCR product was too long to detect Mut/Mut: representing homozygous
N: No expected PCR product detected Mut/+: hemizygous
Y: Expected PCR product detected. +/+: wild type allele

Agarose Gel Electrophoresis

Gel image of PCR products. PCR products are separated by gel electrophoresis on a 2% agarose gel. PC: samples used for PCR are Hemizygous; WT: samples used for PCRare wild type; H2O: blank control.

Gene Editing Results

Number Strain Number Genotype
1 5SQ12- 1 +/+
2 5SQ12- 2 mut/+
3 5SQ12- 3 +/+
4 5SQ12- 4 mut/+
5 5SQ12- 5 mut/+
6 5SQ12- 6 +/+
7 5SQ12- 7 mut/+
8 5SQ12- 8 mut/+
9 5SQ12- 9 mut/+
10 5SQ12- 10 mut/+
11 5SQ12- 11 mut/+
12 5SQ12- 12 mut/+
13 5SQ12- 13 +/+
14 5SQ12- 14 mut/+
15 5SQ12- 15 mut/+
16 5SQ12- 16 mut/+

 

References

1. McHaffie S L, Hastie N D, Chau Y Y. Effects of CreERT2, 4-OH Tamoxifen, and Gender on CFU-F Assays[J]. PloS one, 2016, 11(2): e0148105.

Back to top