B-Cam1(Mcpt5)-iCre mice

Basic Information

Strain Name
C57BL/6-Cma1tm1(iCre)/Bcgen
Stock Number
110138
Common Name
B-Cam1(Mcpt5)-iCre mice
Source/Investigator
Biocytogen Jiangsu Co., Ltd
Related Genes
Cma1 (chymase 1, mast cell, also known as Mcpt5)
Species
C57BL/6
Appearance
Black
Genotypes
Cma1iCre (wt/mut)
Development
An iCre-WPRE-pA cassette was placed at the 5’ end of the Cma1(Mcpt5) gene using C57BL/6 embryonic stem cells.. This strain was maintained on a C57BL/6 genetic background.

Description

Cma1 gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product Size (bp)
Primer-WT-F GCCCTAACTAGGAAGGTAAGATC 58 Mut:430
Primer -Mut-R Gcacacagacaggagcatcttc 61
Primer -WT-F GCCCTAACTAGGAAGGTAAGATC 58 WT:466

Mut: 2318

Primer -WT-R GTCTTGAGAAGGGCTATGAGTC 58

References

1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H; Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]

2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]

3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]

4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]

5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012. Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]

6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]

7. Wang F, Meng M, Mo B, et al. Crosstalks between mTORC1 and mTORC2 variagate cytokine signaling to control NK maturation and effector function[J]. Nature communications, 2018, 9(1): 4874.

Back to top