B-Col2a1-iCre Mice

Basic Information

Strain Name
C57BL/6-Col2a1 tm1(iCre) /Bcgen
Stock Number
Common Name
B-Col2a1-iCre mice
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Col2a1(collagen, type II, alpha 1); Dmm; Lpk; Col2; Del1; Col2a; Col2a- 1; M100856; Rgsc856
Col2a1 iCre (wt/mut, neo deleted)
An F2A-iCre sequence cassette was placed between the coding sequence of exon 54 and 3’UTR of the Col2a1 gene using C57BL/6 embryonic stem cells. To avoid disrupting poly A signal of Col2a1, Neo cassette flanked by frt sites was inserted within the non-conserved region of intron 53. This strain was maintained on a C57BL/6 genetic background.


The Col2a1 gene encodes the alpha-1 chain of type II Collagen, a fibrillar collagen found in cartilage and the vitreous humor of the eye. In this strain, Cre recombinase expression is under the control of Col2a1 promoter in a chondrocyte-specific pattern. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Col2a1 expressing cells.

Targeting Strategy


Genotyping Information

Primer Sequence (5’-3’) Tm(℃) Product size(bp)
Col2a1 iCre primer 1 ATCGCCCAAATGACACCTCC 59 WT: 217
Col2a1 iCre primer 1 ATCGCCCAAATGACACCTCC 59 Mut: 297


The primer LRL-010-FRT-F and LRL-010-FRT-R are used to detect Neo gene


Primer Sequence (5’-3’) Tm
Product size
Mut: 371





1. Baffi MO; Slattery E; Sohn P; Moses HL; Chytil A; Serra R. 2004. Conditional deletion of the TGF-beta type II receptor in Col2a expressing cells results in defects in the axial skeleton without alterations in chondrocyte differentiation or embryonic development of long bones. Dev Biol 276(1):124-42. [PubMed:15531369] [MGI Ref ID J:95024]
2. Oh JH; Park SY; de Crombrugghe B; Kim JE. 2012. Chondrocyte-specific ablation of
Osterix leads to impaired endochondral ossification. Biochem Biophys Res Commun
418(4):634-40. [PubMed: 22290230] [MGI Ref ID J:181485]

Back to top