B-Dcp2-iCreERT2 mice

Basic Information

Strain Name
C57BL/6-Dcp2tm1(icre/ERT2)/Bcgen
Stock Number
110138
Common Name
B-Dcp2-iCreERT2 mice
Source/Investigator
Biocytogen Jiangsu Co., Ltd
Related Genes
Dcp2 (decapping mRNA 2)
Species
C57BL/6
Appearance
Black
Genotype
Dcp2iCre/ERT2 (wt/mut)
Development
A P2A-iCreERT2 cassette was placed between Exon11 and 3’ UTR of the Dcp2 gene using EGE system. This strain was maintained on a C57BL/6 genetic background.

Description

Dcp2 encoded by Dcp2 gene. It is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5′ end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product Size (bp)
Primer-WT-F GAGTGCGTGAAAGGCAATTTCTGGT 63 Mut:444
Primer -Mut-R CACACAGACAGGAGCATCTTCCAGG 63
Primer -WT-F GAGTGCGTGAAAGGCAATTTCTGGT 63 WT:353

Mut:2402

Primer -WT-R CTTTAGAAACATGGCCTCCCTGCAC 63

References

1. Kraev A. Insertional Mutagenesis Confounds the Mechanism of the Morbid Phenotype of a PLNR9C Transgenic Mouse Line[J]. Journal of cardiac failure, 2018, 24(2): 115-125.

2. Pugach E K, Richmond P A, Azofeifa J G, et al. Prolonged Cre expression driven by the α-myosin heavy chain promoter can be cardiotoxic[J]. Journal of molecular and cellular cardiology, 2015, 86: 54-61.

Back to top