B-Gfap-iCre mice

Basic Information

Strain Name
C57BL/6-Gfaptm1(icre)/Bcgen
Stock Number
110155
Common Name
B-Gfap-iCre mice
Source/Investigator
Biocytogen Jiangsu Co., Ltd
Related Genes
Gfap (glial fibrillary acidic protein)
Species
C57BL/6
Appearance
Black
Genotype
Gfap iCre (wt/mut)
Development
An iCre-WPRE-pA cassette was placed at the 5’ end of the Gfap gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at  downstream of pA. This strain was maintained on a C57BL/6 genetic background.

Description

This gene encodes one of the major intermediate filament proteins of mature astrocytes. It is used as a marker to distinguish astrocytes from other glial cells during development. Mutations in this gene cause Alexander disease, a rare disorder of astrocytes in the central nervous system. Alternative splicing results in multiple transcript variants encoding distinct isoforms.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product Size (bp)
110155-WT-F GTCAGGGGCAGATTTAGTCCAACCC 58 WT:194bp
110155-WT-R TCATTCGAGACAAGGAGAAGCGTGG 58
110155-WT-F GTCAGGGGCAGATTTAGTCCAACCC 58 Mut:247bp
110155-Mut-R GCACACAGACAGGAGCATCTTC 57

References

1. The design for ES-GJ-020tm1Mes is based on McCall MA, et al., Targeted deletion in astrocyte intermediate filament (ES-GJ-020) alters neuronal physiology. Proc Natl Acad Sci U S A. 1996 Jun 25;93(13):6361-6.

Back to top