Basic Information
Description
The human GRPR gene and its receptor in tumors suggest that these molecules are part of an autocrine loop for growth. The mouse Grpr is highly expressed both in the lateral nucleus of the amygdala, the nucleus where associations for pavlovian learned fear are formed, and in the regions that convey fearful auditory information to the lateral nucleus. In this strain, iCre recombinase expression is under the control of Grpr promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Grpr expressing cells.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 WT: 213 Mut: 1326
Grpr iCre primer 2 CAATGGTGATTGGTGCATTTGGAC 59 Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 Mut: 244 Grpr iCre primer 3 CCTGTCCCTGAACATGTCCATCAG 61 Polymerase: Taq
-
References
-
1. Maslen, G. L., Boyd, Y. 1993. Comparative mapping of the Grpr locus on the X
chromosomes of man and mouse. Genomics 17: 106-109. [PubMed: 8406441]
2. Shumyatsky, G. P., Tsvetkov, E., Malleret, G., Vronskaya, S., Hatton, M., Hampton, L.,
Battey, J. F., Dulac, C., Kandel, E. R., Bolshakov, V. Y. 2002. Identification of a signaling network in lateral nucleus of amygdala important for inhibiting memory specifically related to learned fear. Cell 111: 905-918. [PubMed: 12526815]
3. Sun, Y.-G., Zhao, Z.-Q., Meng, X.-L., Yin, J., Liu, X.-Y., Chen, Z.-F. Cellular basis of itch
sensation. Science 325: 1531-1534, 2009. [PubMed: 19661382]