B-Grpr-iCre Mice

Basic Information

Strain Name
C57BL/6-Grpr tm1(iCre) /Bcgen
Stock Number
Common Name
B-Grpr-iCre Mice
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Grpr (gastrin releasing peptide receptor); GRP-R
Grpr iCre (wt/mut)
An F2A-iCre sequence cassette was placed between the coding sequence of exon 3 and 3’UTR of the Grpr gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.


The human GRPR gene and its receptor in tumors suggest that these molecules are part of an autocrine loop for growth. The mouse Grpr is highly expressed both in the lateral nucleus of the amygdala, the nucleus where associations for pavlovian learned fear are formed, and in the regions that convey fearful auditory information to the lateral nucleus. In this strain, iCre recombinase expression is under the control of Grpr promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Grpr expressing cells.

Targeting Strategy


Genotyping Information

Primer Sequence (5’-3’) Tm
Product size

Mut: 1326

Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 Mut: 244

Polymerase: Taq




1. Maslen, G. L., Boyd, Y. 1993. Comparative mapping of the Grpr locus on the X
chromosomes of man and mouse. Genomics 17: 106-109. [PubMed: 8406441]
2. Shumyatsky, G. P., Tsvetkov, E., Malleret, G., Vronskaya, S., Hatton, M., Hampton, L.,
Battey, J. F., Dulac, C., Kandel, E. R., Bolshakov, V. Y. 2002. Identification of a signaling network in lateral nucleus of amygdala important for inhibiting memory specifically related to learned fear. Cell 111: 905-918. [PubMed: 12526815]
3. Sun, Y.-G., Zhao, Z.-Q., Meng, X.-L., Yin, J., Liu, X.-Y., Chen, Z.-F. Cellular basis of itch
sensation. Science 325: 1531-1534, 2009. [PubMed: 19661382]

Back to top