Basic Information
-
Targeting Strategy
-
An F2A-iCre sequence cassette was placed between the coding sequence of exon 3 and 3’UTR of the Grpr gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 WT: 213 Mut: 1326
Grpr iCre primer 2 CAATGGTGATTGGTGCATTTGGAC 59 Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 Mut: 244 Grpr iCre primer 3 CCTGTCCCTGAACATGTCCATCAG 61 Polymerase: Taq
-
References
-
1. Maslen, G. L., Boyd, Y. 1993. Comparative mapping of the Grpr locus on the X
chromosomes of man and mouse. Genomics 17: 106-109. [PubMed: 8406441]
2. Shumyatsky, G. P., Tsvetkov, E., Malleret, G., Vronskaya, S., Hatton, M., Hampton, L.,
Battey, J. F., Dulac, C., Kandel, E. R., Bolshakov, V. Y. 2002. Identification of a signaling network in lateral nucleus of amygdala important for inhibiting memory specifically related to learned fear. Cell 111: 905-918. [PubMed: 12526815]
3. Sun, Y.-G., Zhao, Z.-Q., Meng, X.-L., Yin, J., Liu, X.-Y., Chen, Z.-F. Cellular basis of itch
sensation. Science 325: 1531-1534, 2009. [PubMed: 19661382]
