Basic Information

Strain Name
C57BL/6-Grpr tm1(iCre) /Bcgen
Stock Number
110125
Common Name
B-Grpr-iCre Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Grpr (gastrin releasing peptide receptor); GRP-R
Species
C57BL/6N
Appearance
Black
Genotypes
Grpr iCre (wt/mut)
Development
In this strain, iCre recombinase expression is under the control of Grpr promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Grpr expressing cells.
NCBI Gene ID

Targeting Strategy

An F2A-iCre sequence cassette was placed between the coding sequence of exon 3 and 3’UTR of the Grpr gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 WT: 213

Mut: 1326

Grpr iCre primer 2 CAATGGTGATTGGTGCATTTGGAC 59
Grpr iCre primer 1 GGCTACCTTTAGCCTCATCAACAGA 60 Mut: 244
Grpr iCre primer 3 CCTGTCCCTGAACATGTCCATCAG 61

Polymerase: Taq

 

 

References

1. Maslen, G. L., Boyd, Y. 1993. Comparative mapping of the Grpr locus on the X
chromosomes of man and mouse. Genomics 17: 106-109. [PubMed: 8406441]
2. Shumyatsky, G. P., Tsvetkov, E., Malleret, G., Vronskaya, S., Hatton, M., Hampton, L.,
Battey, J. F., Dulac, C., Kandel, E. R., Bolshakov, V. Y. 2002. Identification of a signaling network in lateral nucleus of amygdala important for inhibiting memory specifically related to learned fear. Cell 111: 905-918. [PubMed: 12526815]
3. Sun, Y.-G., Zhao, Z.-Q., Meng, X.-L., Yin, J., Liu, X.-Y., Chen, Z.-F. Cellular basis of itch
sensation. Science 325: 1531-1534, 2009. [PubMed: 19661382]