B-Ins1-iCreERT2 Mice

Basic Information

Strain Name
C57BL/6-Ins1 tm1(iCreERT2) /Bcgen
Stock Number
Common Name
B-Ins1-iCreERT2 Mice
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Ins1 (Insulin I); Ins2-rs1
Ins1 iCreERT2 (wt/mut)
AnIRES-iCreERT2 sequence cassette was placed between the coding sequence of exon 2 and 3’UTR of the Ins1 genein C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.


The Ins1 gene encodes insulin, which is a hormone produced by beta cells in the pancreas and regulates the metabolism of carbohydrates and lipids. In this strain, CreERT2 recombinase expression is under the control of Ins1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, tamoxifen-inducible, Cre-mediated recombination results in deletion of the flanked sequence in Ins1 expressing cells.

Targeting Strategy


Genotyping Information

Primer Sequence (5’-3’) Tm
Product size
Ins1 iCreERT2 primer 3 CTCTACTTCATCGCATTCCTTGC 57 Mut: 311

Polymerase: Taq





1. Thorens B; Tarussio D; Maestro MA; Rovira M; Heikkila E; Ferrer J. 2014. Ins1 knock-in
mice for beta cell-specific gene recombination. Diabetologia. 58(3):558-65. [PMID: 25500700] [MGI Ref ID J:217521]
2. Tamarina NA; Roe MW; Philipson L. 2014. Characterization of mice expressing Ins1
gene promoter driven CreERT recombinase for conditional gene deletion in pancreatic β-
cells. Islets. 6(1): e27685. [PMID:25483876]
3. Sonksen P; Sonksen J. 2000. Insulin: understanding its action in health and disease. Br J Anaesth 85 (1): 69–79. [PMID 10927996]

Back to top