B-Myh6-iCreERT2 mice

Basic Information

Strain Name
C57BL/6-Myh6tm1(iCre/ERT2)/Bcgen
Stock Number
110127
Common Name
B-Myh6-iCreERT2 mice
Source/Investigator
Biocytogen Jiangsu Co., Ltd
Related Genes
Myh6 (myosin, heavy polypeptide 6, cardiac muscle, alpha)
Species
C57BL/6
Appearance
Black
Genotype
Myh6iCre/ERT2 (wt/mut)
Development
A P2A-iCreERT2 cassette was placed between Exon39 and 3’ UTR of the Myh6 gene using EGE system. This strain was maintained on a C57BL/6 genetic background.

Description

Myh6 gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product Size (bp)
Primer-WT-F CAAGGGCATTTTATTAGAGCCACTG 58 WT: 279

Mut: 2340

Primer-WT-R CTTCAGATCTTACAGCTCTGACAGTCC 60
Primer-WT-F CAAGGGCATTTTATTAGAGCCACTG 58 Mut: 424
Primer-Mut-R CTGGCTTGCAGGTACAGGAGGTAG 61

References

1. Kraev A. Insertional Mutagenesis Confounds the Mechanism of the Morbid Phenotype of a PLNR9C Transgenic Mouse Line[J]. Journal of cardiac failure, 2018, 24(2): 115-125.

2. Pugach E K, Richmond P A, Azofeifa J G, et al. Prolonged Cre expression driven by the α-myosin heavy chain promoter can be cardiotoxic[J]. Journal of molecular and cellular cardiology, 2015, 86: 54-61.

Back to top