Basic Information
-
Targeting Strategy
-
An IRES-iCre sequence cassette was placed between the coding sequence of exon 7 and 3’UTR of the Nkp46 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at least 300bp downstream of 3’UTR. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 WT: 285 Ncr1 iCre primer 2 CTTTGCCAAACTTGGTAACACTCC 58 Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 Mut: 282 Ncr1 iCre primer 3 CACACCGGCCTTATTCCAAG 57 Polymerase: Taq
-
References
-
1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H;
Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor
immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012.
Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]7.Wu S, Peng H, Li S, Huang L, Wang X, Li Y, Liu Y, Xiong P, Yang Q, Tian K, Wu W, Pu R, Lu X, Xiao Z, Yang J, Zhong Z, Gao Y, Deng Y, Deng Y. The ω-3 polyunsaturated fatty acid docosahexaenoic acid enhances NK-cell antitumor effector functions. Cancer Immunol Res. 2024 Mar 25.PMID: 38526128.
8.yifeng zhou, Zheng Zhang, Fanrong Li et al. TNBC-Specific UGDH-AS1+ NK Cells Encode NSKM, Promoting Cancer Progression by Inhibiting NK Cells Activity, 21 July 2024, PREPRINT (Version 1) available at Research Square [https://doi.org/10.21203/rs.3.rs-4723989/v1]
