Basic Information

Strain Name
C57BL/6-Ncr1tm1(iCre)/Bcgen
Stock Number
110127
Common Name
B-Nkp46-iCre mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Ncr1 (natural cytotoxicity triggering receptor 1); Ly94; NKp46
Species
C57BL/6N
Appearance
Black
Genotypes
Ncr1 (wt/mut)
Development
In this strain, Cre recombinase expression is under the control of Ncr1 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Ncr1 expressing cells.
NCBI Gene ID

Targeting Strategy

An IRES-iCre sequence cassette was placed between the coding sequence of exon 7 and 3’UTR of the Nkp46 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at least 300bp downstream of 3’UTR. This strain was maintained on a C57BL/6 genetic background.

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 WT: 285
Ncr1 iCre primer 2 CTTTGCCAAACTTGGTAACACTCC 58
Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 Mut: 282
Ncr1 iCre primer 3 CACACCGGCCTTATTCCAAG 57

Polymerase: Taq

References

1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H;
Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor
immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012.
Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]