Basic Information
-
Targeting Strategy
-
An IRES-iCre sequence cassette was placed between the coding sequence of exon 7 and 3’UTR of the Nkp46 gene using C57BL/6 embryonic stem cells. Neo cassette flanked by frt sites was inserted at least 300bp downstream of 3’UTR. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 WT: 285 Ncr1 iCre primer 2 CTTTGCCAAACTTGGTAACACTCC 58 Ncr1 iCre primer 1 CGAATTGGTCTGGCATGCATAATC 58 Mut: 282 Ncr1 iCre primer 3 CACACCGGCCTTATTCCAAG 57 Polymerase: Taq
-
References
-
1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H;
Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]
2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor
immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]
3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]
4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]
5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012.
Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]
6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]