B-Tex264-iCre-EGFP mice

Basic Information

Strain Name
C57BL/6-Tex264tm1(IRES-iCre-GFP)/Bcgen
Stock Number
110136
Common Name
B-Tex264-iCre-EGFP mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Tex264 (testis expressed gene 264, also known asTEG-264)
Species
C57BL/6
Appearance
Black

Description

Tex264 gene is located on mouse chromosome 9 and is mainly highly expressed in the kidney and adrenal gland of adult mice, and is also partially expressed in the other 28 tissues of mice. B-Tex264-IRES-iCre-GFP mice, as a cre tool mouse with 264 promoter-induced expression, achieve gene knockout of specific genes at specific times or tissues by inducing the expression of Cre recombinase and removing the gene between loxP sites.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm () Product size
B-CM-006-WT-F CATGAGTAGACTCTGCATGCTCAG 59 WT:644bp

Mut:3088bp

B-CM-006-WT-R CTGGAAGCTCCAATAAGAGTCTGC 59
B-CM-006-Mut-F GGCACAAGCTGGAGTACAAC 57 Mut:558bp
B-CM-006-WT-R CTGGAAGCTCCAATAAGAGTCTGC 59

References

1. Masahiro Gotoh, et al., Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis. Genes Chromosomes Cancer. 2014 Dec; 53(12): 1018–1032. Published online 2014 Sep 18.

Back to top