B-Tg(Myh6-CreERT2) rats

Basic Information

Strain Name
SD-Tg(Myh6-CreERT2)/Bcgen
Stock Number
210514
Common Name
B-Tg(Myh6-CreERT2) rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Myh6(Mhc-α)
Species
SD rat
Appearance
white

Targeting Strategy

Details

Primer Sequence Tm(℃) Product size
B-TG-003-GT-F TACCAAACCAATTGAATTGCGCTGATGCC 64 Mut: 1313bp
B-TG-003-Insulator-GT-R tgagctcGGTACCGTCGAGaa 60
B-TG-003-CreERT2-F TCTTCGACATGCTGCTGGC 60 Mut: 1510bp
B-TG-003-GT-R TACTCAAGTGAAAGTACAAGTACTTAGG 56

References

Jiang, J., Wakimoto, H., Seidman, J. G., & Seidman, C. E. (2013). Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science, 342(6154), 111-114.

Back to top