Basic Information
Strain Name
SD-Apoa4 tm1 /Bcgen
Stock Number
210505
Common Name
B-Apoa4 KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Apoa4 (apolipoprotein A-IV)
Species
Sprague Dawley
Appearance
White
Genotypes
Apoa4 KO (mut/mut)
Development
The Apoa4 KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses an 8 bp deletion within Exon 2 on chromosome 8 causing a protein frame shift. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
Description
Apolipoprotein A4 is a plasma protein and synthesized in the intestine and liver. ApoA4 is secreted into circulation on the surface of newly synthesized chylomicron particles. The primary functions of ApoA4 have not been clearly established; however, ApoA4 has been implicated in regulating appetite and satiety in rodent models, modulating the lipid transport in vitro, and activating lecithin-cholesterol acyltransferase and cholesterylester transfer protein in vitro.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm (℃ Product size (bp) Apoa4KO primer 1 GACGCTAGGAAACATCCAGTGTAGC 62 Mut: 694 WT: 702
Apoa4KO primer 2 CCATTTACCAAACGCTAGCACATGC 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Whited KL; Tso P; Raybould HE. 2007. Involvement of apolipoprotein A-IV and cholecystokinin1 receptors in exogenous peptide YY3 36-induced stimulation of intestinal feedback. Endocrinology 148(10):4695-703. [PubMed: 17641001]
- Li X; Xu M; Wang F; Kohan AB; Haas MK; Yang Q; Lou D; Obici S; Davidson WS; Tso P. 2014. Apolipoprotein A-IV reduces hepatic gluconeogenesis through nuclear receptor NR1D1. J Biol Chem 289(4):2396-404. [PubMed: 24311788] [MGI Ref ID J:209530]
- Yoshimichi G; Lo CC; Tamashiro KL; Ma L; Lee DM; Begg DP; Liu M; Sakai RR; Woods SC; Yoshimatsu H; Tso P. 2012. Effect of peripheral administration of cholecystokinin on food intake in apolipoprotein AIV knockout mice. Am J Physiol Gastrointest Liver Physiol 302(11):G1336-42. [PubMed: 22461023] [MGI Ref ID J:191161]