Basic Information
Strain Name
SD-Apoa4 tm1 /Bcgen
Stock Number
210505
Common Name
B-Apoa4 KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Apoa4 (apolipoprotein A-IV)
Background
Sprague Dawley
Appearance
White
Genotypes
Apoa4 KO (mut/mut)
NCBI Gene ID
Description
The Apoa4 KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain. This model possesses an 8 bp deletion within Exon 2 on chromosome 8 causing a protein frame shift. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
-
Targeting strategy
-
-
Genotyping information
-
Primer Sequence (5’-3’) Tm (℃ Product size (bp) Apoa4KO primer 1 GACGCTAGGAAACATCCAGTGTAGC 62 Mut: 694 WT: 702
Apoa4KO primer 2 CCATTTACCAAACGCTAGCACATGC 62 Polymerase: Taq
The fragments need to be verified by sequencing.
-
References
-
- Whited KL; Tso P; Raybould HE. 2007. Involvement of apolipoprotein A-IV and cholecystokinin1 receptors in exogenous peptide YY3 36-induced stimulation of intestinal feedback. Endocrinology 148(10):4695-703. [PubMed: 17641001]
- Li X; Xu M; Wang F; Kohan AB; Haas MK; Yang Q; Lou D; Obici S; Davidson WS; Tso P. 2014. Apolipoprotein A-IV reduces hepatic gluconeogenesis through nuclear receptor NR1D1. J Biol Chem 289(4):2396-404. [PubMed: 24311788] [MGI Ref ID J:209530]
- Yoshimichi G; Lo CC; Tamashiro KL; Ma L; Lee DM; Begg DP; Liu M; Sakai RR; Woods SC; Yoshimatsu H; Tso P. 2012. Effect of peripheral administration of cholecystokinin on food intake in apolipoprotein AIV knockout mice. Am J Physiol Gastrointest Liver Physiol 302(11):G1336-42. [PubMed: 22461023] [MGI Ref ID J:191161]
