Basic Information
Strain Name
SD-Apoe tm1 /Bcgen
Stock Number
210508
Common Name
B-Apoe KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Apoe (apolipoprotein E)
Species
Sprague Dawley
Appearance
White
Genotypes
Apoe KO (mut/mut)
Development
The Apoe KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses a 13 bp deletion within Exon 3 on chromosome 1. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
Description
Apolipoprotein E (ApoE) is primarily produced by the liver and macrophages in the peripheral tissues, or by astrocytes and microglia in the central nervous system. ApoE transports lipoproteins, fat-soluble vitamins and cholesterol into the lymph systems, and then into the blood, preventing the accumulation of cholesterol-rich particles in the plasma. The function of ApoE protein has been widely studied in cardiovascular disease, lipid metabolism, and Alzheimer’s diseases.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product
size (bp)Apoe KO primer 1 GTTGGTCCCATTGCTGACAG 62 Mut: 735
WT: 748Apoe KO primer 2 CAGATAGGAGGAACCCCTGGAT 62 Polymerase: Taq
The fragments need to be verified by sequencing. -
References
-
- Ishibashi S; Herz J; Maeda N; Goldstein JL; Brown MS. 1994. The two-receptor model of
lipoprotein clearance: tests of the hypothesis in knockout mice lacking the low density
lipoprotein receptor, apolipoprotein E, or both proteins. Proc Natl Acad Sci U S A
91(10):4431-5. [PubMed: 8183926] - Miura Y; Chiba T; Tomita I; Koizumi H; Miura S; Umegaki K; Hara Y; Ikeda M; Tomita T. 2001. Tea catechins prevent the development of atherosclerosis in apoprotein E-deficient mice. J Nutr 131(1):27-32[PubMed: 11208934]
- Ekuni, D., et al., Occlusal disharmony accelerates the initiation of atherosclerosis in apoE knockout rats. Lipids Health Dis, 2014. 13: p. 144. [PubMed: 25189624]
- Ishibashi S; Herz J; Maeda N; Goldstein JL; Brown MS. 1994. The two-receptor model of