Basic Information

Strain Name
C57BL/6-Gt(ROSA)26ortm8(CAG-LSL-DTR-EGFP)/Bcgen
Stock Number
110151
Common Name
B-CAG-DTR-EGFP cKI Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
ROSA26 (ROSA26Sor) ; HBEGF (heparin binding EGF like growth factor,as known as DTR)
Species
C57BL/6
Appearance
Black

Targeting Strategy

Details

Genotyping Information

Primer Sequence(5’-3’) Tm

()

Product sizebp
B-CM-118-GT-F AGTCGCTCTGAGTTGTTATCAG 57 WT:469bp
B-CM-118-GT-R TGAGCATGTCTTTAATCTACCTCGATG 58
B-CM-118-Mut-F AGATGAACTTCAGGGTCAGCTTGC 61 Mut:323bp
B-CM-118-Mut-R CTCTGTCTGTCTGCTGGTCATCGT 62

References

Srinivas, S., T. Watanabe, et al. (2001). “Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ES-ZQ2-001 locus.” BMC Dev Biol 1: 4.

Back to top