Basic Information

Strain Name
C57BL/6-F9 tm1Bcgen/Bcgen
Stock Number
110170
Common Name
B-F9 KO mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
F9;FIX(coagulation factor IX)
Background
C57BL/6
Appearance
Black
Genotypes
Heterozygote
Development
The B-F9 KO mice were developed by Beijing Biocytogen Co., Ltd. The Exons 1-3 of mice were knocked out.
NCBI Gene ID

Targeting Strategy

B-F9-KO-mice-Targeting-Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
F9-Mut-F3 GGTACTGTGTACTGTTCCCAATTACAG
A
63 WT: 7049
Mut: 563
F9-Mut-R2 GAATTGGACCTCAGGTAGATGGAGC 63
F9-WT-F3 AACACGTTGCAGAAAGATCCTGTCA 63 WT: 474
F9-WT-R3 AAGTCAGCCTGTGAAATGTCCCTCA 64

Polymerase: Taq

Application

NovoSeven efficacy evaluation

B-F9-KO-mice-NovoSeven efficacy evaluation

Animals were randomly divided into Control group or NovoSeven (1 mg/kg), After 30 minutes treatment, the abdominal aorta was collected blood for ATPP (activated partial thromboplastin time) and FIB (Fibrinogen) detection. The results showed that the APTT recovered to normal after drug treatment compared with the control group. FIB values were not significantly different from WT mice. A:ATPP±SEM; B: FIB±SEM.

References

  1. Blood. 1998 Jul 1;92(1):168-74
  2. Proc Natl Acad Sci U S A. 1997 Oct 14;94(21):11563-6.
  3. Xia Wu, Feixu Zhang, Xinyue Zhou et al. Activated Factor X delivered by Adeno-Associated virus significantly inhibited bleeding and alleviated hemophilia A/B arthropathy in hemophilia mice, 05 January 2024, PREPRINT (Version 1) available at Research Square
Back to top