Basic Information
Strain Name
SD-Il2rg tm1 /Bcgen
Stock Number
210513
Common Name
B-IL2rg KO rats
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Il2rg (interleukin 2 receptor, gamma)
Species
Sprague Dawley
Appearance
White
Genotypes
Il2rg KO (mut/mut)
Development
The Il2rg KO rat was developed using targeted TALEN technology in the Sprague-Dawley strain, and this model possesses a 14 bp deletion within Exon 2 on chromosome X. This strain was maintained by mating homozygous males with homozygous females on a Sprague-Dawley genetic background.
Description
Il2rg is known as the interleukin receptor common gamma chain, which is an important signaling component of many interleukin receptors, including those of interleukin -2, -4, -7 and -21. Mutations in this gene cause X-linked severe combined immunodeficiency.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)IL2rg KO primer 1 GCTCCAAGGTCCTCATGTCCAG 62 Mut: 915
WT: 929IL2rg KO primer 2 ATCTTCGCCTTTCTGCCCATGAC 62 Polymerase: KOD-FX
The fragments need to be verified by sequencing. -
References
-
- Ohbo, K., et al., Modulation of hematopoiesis in mice with a truncated mutant of the interleukin-2 receptor gamma chain. Blood, 1996. 87(3): p. 956-67. [PubMed: 8562967]
- Mashimo, T., et al., Generation of knockout rats with X-linked severe combined
immunodeficiency (X-SCID) using zinc-finger nucleases. PLoS One, 2010. 5(1): p. e8870.
[PubMed: 20111598] - Mashimo, T., et al., Generation and characterization of severe combined immunodeficiency rats. Cell Rep, 2012. 2(3): p. 685-94. [PubMed: 22981234]