Basic Information

Strain Name
C57BL/6-Trp53 tm1 /Bcgen
Stock Number
110167
Common Name
B-p53 KO mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
p53; Trp53
Species
C57BL/6J
Appearance
Black
Genotypes
Trp53 (mut/mut); Trp53 (mut/wt)
Development
The Trp53- mice were developed by Beijing Biocytogen Co., Ltd. The targeted mouse Trp53 exons 2-7 were replaced with pGK-Neo cassette resulting in inactivation of Trp53 protein. The C57BL/6 ES cell line was used.
NCBI Gene ID

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Trp53 primer 1 AGTTCTGCCACGTGGTTGGT 60 WT: 281
Trp53 primer 2 GTCTCCTGGCTCAGAGGGAG 60
Trp53 primer 1 AGTTCTGCCACGTGGTTGGT 60 Mut: 441
Trp53 primer 3 CAGAGGCCACTTGTGTAGCG 60

Polymerase: Taq

 

 

 

 

Publications

  1. Silencing of functional p53 attenuates NAFLD by promoting HMGB1-related autophagy induction
  2. Olaquindox-Induced Liver Damage Involved the Crosstalk of Oxidative Stress and p53 In Vivo and In Vitro
  3. SIRT6 as a key event linking P53 and NRF2 counteracts APAP-induced hepatotoxicity through inhibiting oxidative stress and promoting hepatocyte proliferation
  4. p53-mediated control of aspartate-asparagine homeostasis dictates LKB1 activity and modulates cell survival
  5. Mutant p53 Drives Cancer Metastasis via RCP-Mediated Hsp90α Secretion
  6. Heavy ion radiation-induced DNA damage mediates apoptosis via the Rpl27a-Rpl5-MDM2-p53/E2F1 signaling pathway in mouse spermatogonia
  7. Deficiency in the anti-apoptotic protein DJ-1 promotes intestinal epithelial cell apoptosis and aggravates inflammatory bowel disease via p53

References

1. Jacks T; Remington L; Williams BO; Schmitt EM; Halachmi S; Bronson RT; Weinberg RA. 1994. Tumor spectrum analysis in p53-mutant mice. Curr Biol 4(1):1-7. [PMID: 7922305]

2. Shao C; Deng L; Henegariu O; Liang L; Stambrook PJ; Tischfield JA. 2000. Chromosome instability contributes to loss of heterozygosity in mice lacking p53. Proc Natl Acad Sci U S A 97(13):7405-10. [PMID: 10861008]