Basic Information

Strain Name
C57BL/6-Trp53 tm1 /Bcgen
Stock Number
Common Name
B-p53 KO mice
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
p53; Trp53
Trp53 (mut/mut); Trp53 (mut/wt)
The Trp53- mice were developed by Beijing Biocytogen Co., Ltd. The targeted mouse Trp53 exons 2-7 were replaced with pGK-Neo cassette resulting in inactivation of Trp53 protein. The C57BL/6 ES cell line was used.


The Trp53 gene encodes tumor protein p53, which involves in diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. P53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines. Mice with homozygous p53 inactivation are developmentally normal but are susceptible to spontaneous tumors.

Targeting Strategy


Genotyping Information

Primer Sequence (5’-3’) Tm
Product size
Trp53 primer 1 AGTTCTGCCACGTGGTTGGT 60 WT: 281
Trp53 primer 1 AGTTCTGCCACGTGGTTGGT 60 Mut: 441

Polymerase: Taq






1. Jacks T; Remington L; Williams BO; Schmitt EM; Halachmi S; Bronson RT; Weinberg RA. 1994. Tumor spectrum analysis in p53-mutant mice. Curr Biol 4(1):1-7. [PMID: 7922305]

2. Shao C; Deng L; Henegariu O; Liang L; Stambrook PJ; Tischfield JA. 2000. Chromosome instability contributes to loss of heterozygosity in mice lacking p53. Proc Natl Acad Sci U S A 97(13):7405-10. [PMID: 10861008]

Back to top