Basic Information
Description
The Trp53 gene encodes tumor protein p53, which involves in diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. P53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines. Mice with homozygous p53 inactivation are developmentally normal but are susceptible to spontaneous tumors.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Trp53 primer 1 AGTTCTGCCACGTGGTTGGT 60 WT: 281 Trp53 primer 2 GTCTCCTGGCTCAGAGGGAG 60 Trp53 primer 1 AGTTCTGCCACGTGGTTGGT 60 Mut: 441 Trp53 primer 3 CAGAGGCCACTTGTGTAGCG 60 Polymerase: Taq
-
References
-
1. Jacks T; Remington L; Williams BO; Schmitt EM; Halachmi S; Bronson RT; Weinberg RA. 1994. Tumor spectrum analysis in p53-mutant mice. Curr Biol 4(1):1-7. [PMID: 7922305]
2. Shao C; Deng L; Henegariu O; Liang L; Stambrook PJ; Tischfield JA. 2000. Chromosome instability contributes to loss of heterozygosity in mice lacking p53. Proc Natl Acad Sci U S A 97(13):7405-10. [PMID: 10861008]