Basic Information

Strain Name
C57BL/6-Tgfb1 tm1 /Bcgen
Stock Number
B-EM-022
Common Name
TGFb1-cKO Mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Tgfb1; TGF-Beta1 (transforming growth factor, beta 1)
Species
C57BL/6
Appearance
Black
Genotypes
Tgfb1 CKO (mut/mut)
Development
A designed targeting vector containing 5’-homologous arm, loxP-Exon2- frt-Neo-frt-loxP, 3’-homologous arm, and DTA selection marker was introduced into C57BL/6 ES cells, replacing corresponding Tgfb1 exon 2 locus. The resulting chimeric animals were crossed to C57BL/6 mice to establish the colony.

Description

TGFB isoforms are important cytokines that influence cell growth, cell differentiation, apoptosis, and cellular homeostasis. TGF-β1 plays an important role in controlling the immune system, and shows different activities on different types of cell, or cells at different developmental stages. Most immune cells (or leukocytes) secrete TGF- β1.

Targeting Strategy

B-TGFb1-cKO-mice-Targeting-Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
Tgfb1 CKO primer 1 AGGCTAACTCCCAGTGAACAGC 60 WT: 182
Mut: 238
Tgfb1 CKO primer 2 CCAGTAGCGGCCAAACTTCTC 59

Polymerase: Taq

 

 

References

1. Shull MM; Ormsby I; Kier AB; Pawlowski S; Diebold RJ; Yin M; Allen R; Sidman C; Proetzel G; Calvin D; Annunziata N; Doetschman T. 1992. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359(6397):693-9. [PMID: 1436033];
2. Boivin GP; O'Toole BA; Orsmby IE; Diebold RJ; Eis MJ; Doetschman T; Kier AB. 1995. Onset and progression of pathological lesions in transforming growth factor-beta 1-deficient mice. Am J Pathol 146(1):276-88. [PMID: 7856734];
3. Engle SJ; Ormsby I; Pawlowski S; Boivin GP; Croft J; Balish E; Doetschman T. 2002.
Elimination of Colon Cancer in Germ-free Transforming Growth Factor Beta 1-deficient Mice. Cancer Res 62(22):6362-6. [PMID: 12438215]

Back to top