Basic Information

Strain Name
C57BL/6-Sp7 tm1(iCre) /Bcgen
Stock Number
110131
Common Name
B-Sp7-iCre mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Sp7 (transcription factor 7); C22; Osx; 6430578P22Rik
Species
C57BL/6N
Appearance
Black
Genotypes
Sp7 iCre (wt/mut)
Development
In this strain, Cre recombinase expression is under the control of Sp7 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Sp7 expressing cells.
NCBI Gene ID

Targeting Strategy

An F2A-iCre sequence cassette was placed between the coding sequence of exon 2 and 3’UTR of the Sp7 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Sp7 iCre primer 1 TACCAGAAGCGACCACTTGAGC 60 WT: 263
Sp7 iCre primer 2 CGCCAAGAGAGCCTGGCAAG 62
Sp7 iCre primer 1 TACCAGAAGCGACCACTTGAGC 60 Mut: 445
Sp7 iCre primer 3 GCACACAGACAGGAGCATCTTC 59

Polymerase: Taq

References

1. Rodda SJ; McMahon AP. 2006. Distinct roles for Hedgehog and canonical Want signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 133(16):3231-44. [PubMed: 16854976]
2. Canalis E; Parker K; Feng JQ; Zanotti S. 2013. Osteoblast lineage-specific effects of notch activation in the skeleton. Endocrinology 154(2):623-34. [PubMed: 23275471] [MGI Ref ID J:194661] Canalis E; Parker K; Feng JQ; Zanotti S. 2013. Osteoblast lineage-specific effects of notch activation in the skeleton. Endocrinology 154(2):623-34. [PubMed: 23275471]
3. Chen J; Shi Y; Regan J; Karuppaiah K; Ornitz DM; Long F. 2014. Osx-Cre targets multiple cell types besides osteoblast lineage in postnatal mice. PLoS One 9(1):e85161. [PubMed: 24454809]
4. Liu Y; Strecker S; Wang L; Kronenberg MS; Wang W; Rowe DW; Maye P. 2013. Osterix-cre labeled progenitor cells contribute to the formation and maintenance of the bone marrow stroma. PLoS One 8(8):e71318. [PubMed: 23951132]
5. Shekaran A; Shoemaker JT; Kavanaugh TE; Lin AS; LaPlaca MC; Fan Y; Guldberg RE;
Garcia AJ. 2014. The effect of conditional inactivation of beta 1 integrins using twist 2 Cre, Osterix Cre and osteocalcin Cre lines on skeletal phenotype. Bone 68:131-41. [PubMed: 25183373]