Basic Information
Description
The Sp7 gene is a C2H2-type zinc finger transcription factor of the SP gene family and putative master regulator of bone cell differentiation. In this strain, Cre recombinase expression is under the control of Sp7 promoter. When crossed with a strain containing a loxP site-flanked sequence of interest, Cre-mediated recombination results in deletion of the flanked sequence in Sp7 expressing cells.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Sp7 iCre primer 1 TACCAGAAGCGACCACTTGAGC 60 WT: 263 Sp7 iCre primer 2 CGCCAAGAGAGCCTGGCAAG 62 Sp7 iCre primer 1 TACCAGAAGCGACCACTTGAGC 60 Mut: 445 Sp7 iCre primer 3 GCACACAGACAGGAGCATCTTC 59 Polymerase: Taq
-
References
-
1. Rodda SJ; McMahon AP. 2006. Distinct roles for Hedgehog and canonical Want signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 133(16):3231-44. [PubMed: 16854976]
2. Canalis E; Parker K; Feng JQ; Zanotti S. 2013. Osteoblast lineage-specific effects of notch activation in the skeleton. Endocrinology 154(2):623-34. [PubMed: 23275471] [MGI Ref ID J:194661] Canalis E; Parker K; Feng JQ; Zanotti S. 2013. Osteoblast lineage-specific effects of notch activation in the skeleton. Endocrinology 154(2):623-34. [PubMed: 23275471]
3. Chen J; Shi Y; Regan J; Karuppaiah K; Ornitz DM; Long F. 2014. Osx-Cre targets multiple cell types besides osteoblast lineage in postnatal mice. PLoS One 9(1):e85161. [PubMed: 24454809]
4. Liu Y; Strecker S; Wang L; Kronenberg MS; Wang W; Rowe DW; Maye P. 2013. Osterix-cre labeled progenitor cells contribute to the formation and maintenance of the bone marrow stroma. PLoS One 8(8):e71318. [PubMed: 23951132]
5. Shekaran A; Shoemaker JT; Kavanaugh TE; Lin AS; LaPlaca MC; Fan Y; Guldberg RE;
Garcia AJ. 2014. The effect of conditional inactivation of beta 1 integrins using twist 2 Cre, Osterix Cre and osteocalcin Cre lines on skeletal phenotype. Bone 68:131-41. [PubMed: 25183373]