Basic Information
-
Targeting Strategy
-
An F2A-iCre sequence cassette was placed between the coding sequence of exon 2 and 3’UTR of the Sp7 gene in C57BL/6 ES cells. This strain was maintained on a C57BL/6 genetic background.
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Sp7 iCre primer 1 TACCAGAAGCGACCACTTGAGC 60 WT: 263 Sp7 iCre primer 2 CGCCAAGAGAGCCTGGCAAG 62 Sp7 iCre primer 1 TACCAGAAGCGACCACTTGAGC 60 Mut: 445 Sp7 iCre primer 3 GCACACAGACAGGAGCATCTTC 59 Polymerase: Taq
-
References
-
1. Rodda SJ; McMahon AP. 2006. Distinct roles for Hedgehog and canonical Want signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 133(16):3231-44. [PubMed: 16854976]
2. Canalis E; Parker K; Feng JQ; Zanotti S. 2013. Osteoblast lineage-specific effects of notch activation in the skeleton. Endocrinology 154(2):623-34. [PubMed: 23275471] [MGI Ref ID J:194661] Canalis E; Parker K; Feng JQ; Zanotti S. 2013. Osteoblast lineage-specific effects of notch activation in the skeleton. Endocrinology 154(2):623-34. [PubMed: 23275471]
3. Chen J; Shi Y; Regan J; Karuppaiah K; Ornitz DM; Long F. 2014. Osx-Cre targets multiple cell types besides osteoblast lineage in postnatal mice. PLoS One 9(1):e85161. [PubMed: 24454809]
4. Liu Y; Strecker S; Wang L; Kronenberg MS; Wang W; Rowe DW; Maye P. 2013. Osterix-cre labeled progenitor cells contribute to the formation and maintenance of the bone marrow stroma. PLoS One 8(8):e71318. [PubMed: 23951132]
5. Shekaran A; Shoemaker JT; Kavanaugh TE; Lin AS; LaPlaca MC; Fan Y; Guldberg RE;
Garcia AJ. 2014. The effect of conditional inactivation of beta 1 integrins using twist 2 Cre, Osterix Cre and osteocalcin Cre lines on skeletal phenotype. Bone 68:131-41. [PubMed: 25183373]