Basic Information

Strain Name
C57BL/6-Il17a tm1 /Bcgen
Stock Number
110161
Common Name
B-Il17a-EGFP mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
Il17; Ctla8; IL-17; Ctla-8; IL-17A
Species
C57BL/6
Appearance
Black
Genotypes
Il17a EGFP (mut/mut)
Development
The Il17a EGFP mice were developed by Beijing Biocytogen Co., Ltd. An IRES-EGFP-SV40-polyA signal sequence cassette was inserted after the stop codon of the Il17a gene using C57BL/6-derived embryonic stem (ES) cells. This strain was maintained on a C57BL/6 genetic background.

Description

The IL17A is a pro-inflammatory cytokine that, although expressed by several cell types, defines the T helper 17 (TH17) cell subset. IL17A activates signal transduction pathways that recruit neutrophils, promote the production of antimicrobial factors, and drive the inflammatory pathology associated with autoimmune disorders.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product size
(bp)
Il17a EGFP primer 1 AAGCTGGACCACCACATGA 62 WT: 264
Il17a EGFP primer 2 TGAATCCACATTCCTTGCTG 62
Il17a EGFP primer 1 AAGCTGGACCACCACATGA 62 Mut: 390
Il17a EGFP primer 3 GACATTCAACAGACCTTGCATTC 62

Polymerase: Taq

 

 

 

References

1. Colpitts SL; Puddington L; Lefrancois L. 2015. IL-15 receptor alpha signaling constrains the development of IL-17 producing gammadelta T cells. Proc Natl Acad Sci U S A 112(31):9692- 7. [PubMed: 26195801]
2.Taylor PR; Roy S; Leal SM Jr; Sun Y; Howell SJ; Cobb BA; Li X; Pearlman E. 2014.
Activation of neutrophils by autocrine IL-17A-IL-17RC interactions during fungal infection is regulated by IL-6, IL-23, RORgammat and dectin-2. Nat Immunol 15(2):143-51. [PMID:
24362892]
3. Goto Y; Panea C; Nakato G; Cebula A; Lee C; Diez MG; Laufer TM; Ignatowicz L; Ivanov
II. 2014. Segmented filamentous bacteria antigens presented by intestinal dendritic cells drive mucosal Th17 cell differentiation. Immunity 40(4):594-607. [PMID: 24684957]
4. Duhen R; Glatigny S; Arbelaez CA; Blair TC; Oukka M; Bettelli E. 2013. Cutting Edge: The Pathogenicity of IFN-gamma-Producing Th17 Cells Is Independent of T-bet. J Immunol 190(9):4478-82. [PMID: 23543757]
5. Lee Y; Awasthi A; Yosef N; Quintana FJ; Xiao S; Peters A; Wu C; Kleinewietfeld M; Kunder S; Hafler DA; Sobel RA; Regev A; Kuchroo VK. 2012. Induction and molecular signature of pathogenic T(H)17 cells. Nat Immunol 13(10):991-9. [PMID: 22961052]