Basic Information
Description
The IL17A is a pro-inflammatory cytokine that, although expressed by several cell types, defines the T helper 17 (TH17) cell subset. IL17A activates signal transduction pathways that recruit neutrophils, promote the production of antimicrobial factors, and drive the inflammatory pathology associated with autoimmune disorders.
-
Targeting Strategy
-
Details
-
Genotyping Information
Primer Sequence (5’-3’) Tm
(℃)Product size
(bp)Il17a EGFP primer 1 AAGCTGGACCACCACATGA 62 WT: 264 Il17a EGFP primer 2 TGAATCCACATTCCTTGCTG 62 Il17a EGFP primer 1 AAGCTGGACCACCACATGA 62 Mut: 390 Il17a EGFP primer 3 GACATTCAACAGACCTTGCATTC 62 Polymerase: Taq
-
References
-
1. Colpitts SL; Puddington L; Lefrancois L. 2015. IL-15 receptor alpha signaling constrains the development of IL-17 producing gammadelta T cells. Proc Natl Acad Sci U S A 112(31):9692- 7. [PubMed: 26195801]
2.Taylor PR; Roy S; Leal SM Jr; Sun Y; Howell SJ; Cobb BA; Li X; Pearlman E. 2014.
Activation of neutrophils by autocrine IL-17A-IL-17RC interactions during fungal infection is regulated by IL-6, IL-23, RORgammat and dectin-2. Nat Immunol 15(2):143-51. [PMID:
24362892]
3. Goto Y; Panea C; Nakato G; Cebula A; Lee C; Diez MG; Laufer TM; Ignatowicz L; Ivanov
II. 2014. Segmented filamentous bacteria antigens presented by intestinal dendritic cells drive mucosal Th17 cell differentiation. Immunity 40(4):594-607. [PMID: 24684957]
4. Duhen R; Glatigny S; Arbelaez CA; Blair TC; Oukka M; Bettelli E. 2013. Cutting Edge: The Pathogenicity of IFN-gamma-Producing Th17 Cells Is Independent of T-bet. J Immunol 190(9):4478-82. [PMID: 23543757]
5. Lee Y; Awasthi A; Yosef N; Quintana FJ; Xiao S; Peters A; Wu C; Kleinewietfeld M; Kunder S; Hafler DA; Sobel RA; Regev A; Kuchroo VK. 2012. Induction and molecular signature of pathogenic T(H)17 cells. Nat Immunol 13(10):991-9. [PMID: 22961052]