B-CAG-tdTomato cKI mice

Basic Information

Strain Name
C57BL/6-Gt (ROSA)26or tm5(CAG-LSL-tdTomato) /Bcgen
Stock Number
110148
Common Name
B-CAG-tdTomato cKI mice
Source/Investigator
Bcgen (Beijing Biocytogen Co., Ltd)
Related Genes
ROSA26 (R26, AV258896, Gtrgeo26, Gtrosa26, Thumpd3as1)
Species
C57BL/6
Appearance
Black
Genotypes
Heterozygous

Description

ROSA26 gene produces a long non-coding RNA (lncRNA) that is under the control of a constitutive promoter. This locus is a widely used site for the integration of transgenes and reporter constructs.

Targeting Strategy

A CAG promoter, TdTomato coding sequence, and WPRE sequence were knocked into the ROSA site, and an LSL (loxp-3 × stop-loxp) sequence was inserted between the CAG promoter and the TdTomato sequence. This mouse normally does not express red fluorescence due to the presence of 3 × stop. When mated with Cre mice or TAM-activated CreERT2 mice, the lox-flanked 3x stop sequence got excised by Cre recombinase in the offspring, thus TdTomato is expressed, which can emit red fluorescence in Cre or CreERT2 expressing tissues, indicating the location of the gene.

Details

Phenotype

B-CAG-tdTomato-cKI-mice-Details

T cells were isolated from spleen in single positive mice and double-positive mice.The proportion of lymphocyte subpopulation were analyzed by flow cytometry.

Results: tdTomato+ cells were detected in the double-positive mice

Protein expression analysis (peripheral blood )

B-CAG-tdTomato-cKI-mice-Results

T cells were isolated from peripheral blood in the single positive mice and the double- positive mice. The proportion of lymphocyte subpopulation were analyzed by flow cytometry.

Results: tdTomato+ cells were detected in the double-positive mice.

Genotyping Information

Primer Sequence (5’-3’) Tm
(℃)
Product
size (bp)
ROSA-GT-F AGTCGCTCTGAGTTGTTATCAG 55 WT:469
Mut:6044
ROSA-GT-R TGAGCATGTCTTTAATCTACCTCGATG 57
ROSA-GT-F AGTCGCTCTGAGTTGTTATCAG 55 Mut:268
ROSA-PCR-R AGTCCCTATTGGCGTTACTATGG 57

Enzyme: Taq

 

 

References

1. Srinivas, Shankar, et al. "Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus." BMC developmental biology 1.1 (2001): 4.

Back to top