B-Cdh5-iCreERT2 mice

Basic Information

Strain Name
C57BL/6-Cdh5tm1(iCre/ERT2)/Bcgen
Stock Number
110140
Common Name
B-Cdh5-iCreERT2 mice
Source/Investigator
Biocytogen Jiangsu Co., Ltd
Related Genes
Cdh5 (cadherin 5)
Species
C57BL/6
Appearance
Black
Genotype
Cdh5iCre/ERT2 (wt/mut)
Development
An iCreERT2-WPRE-pA cassette was placed at the 5’ end of the Cdh5 gene using EGE system. This strain was maintained on a C57BL/6 genetic background.

Description

Cdh5 gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein die in utero due to vascular insufficiency, caused by increased endothelial apoptosis. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8.

Targeting Strategy

Details

Genotyping Information

Primer Sequence (5’-3’) Tm (℃) Product Size (bp)
Primer-WT-F GCTTGCCTTCCCTACTTAGACTAGC 63 WT: 374
Primer-WT-R TAGTGGGGCAGCGATTCATTTTTCT 61
Primer-WT-F GCTTGCCTTCCCTACTTAGACTAGC 63 Mut: 336
Primer-Mut-R GCACACAGACAGGAGCATCTTC 62

References

1. Chaushu S; Wilensky A; Gur C; Shapira L; Elboim M; Halftek G; Polak D; Achdout H; Bachrach G; Mandelboim O. 2012. Direct recognition of Fusobacterium nucleatum by the NK cell natural cytotoxicity receptor NKp46 aggravates periodontal disease. PLoS Pathog 8(3):e1002601. [PubMed:22457623]

2. Elboim M; Gazit R; Gur C; Ghadially H; Betser-Cohen G; Mandelboim O. 2010. Tumor immunoediting by NKp46. J Immunol 184(10):5637-44. [PubMed:20404273]

3. Ghadially H; Horani A; Glasner A; Elboim M; Gazit R; Shoseyov D; Mandelboim O. 2013. NKp46 regulates allergic responses. Eur J Immunol 43(11):3006-16. [PubMed: 23878025]

4. Ghadially H; Ohana M; Elboim M; Gazit R; Gur C; Nagler A; Mandelboim O. 2014. NK Cell Receptor NKp46 Regulates Graft-versus-Host Disease. Cell Rep 7(6):1809-14. [PubMed: 24882008]

5. Glasner A; Ghadially H; Gur C; Stanietsky N; Tsukerman P; Enk J; Mandelboim O. 2012. Recognition and Prevention of Tumor Metastasis by the NK Receptor NKp46/NCR1. J Immunol 188(6):2509-15. [PubMed: 22308311]

6. Gur C; Porgador A; Elboim M; Gazit R; Mizrahi S; Stern-Ginossar N; Achdout H; Ghadially H; Dor Y; Nir T; Doviner V; Hershkovitz O; Mendelson M; Naparstek Y; Mandelboim O. 2010. The activating receptor NKp46 is essential for the development of type 1 diabetes. Nat Immunol 11(2):121-8. [PubMed: 20023661]

7. Wang F, Meng M, Mo B, et al. Crosstalks between mTORC1 and mTORC2 variagate cytokine signaling to control NK maturation and effector function[J]. Nature communications, 2018, 9(1): 4874.

Back to top